Incidental Mutation 'R4127:Gga2'
ID315439
Institutional Source Beutler Lab
Gene Symbol Gga2
Ensembl Gene ENSMUSG00000030872
Gene Namegolgi associated, gamma adaptin ear containing, ARF binding protein 2
Synonyms
MMRRC Submission 040860-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4127 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location121986722-122021222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 122002720 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 205 (H205N)
Ref Sequence ENSEMBL: ENSMUSP00000115581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033160] [ENSMUST00000124566]
Predicted Effect probably damaging
Transcript: ENSMUST00000033160
AA Change: H205N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000033160
Gene: ENSMUSG00000030872
AA Change: H205N

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
VHS 29 162 2.45e-58 SMART
Pfam:GAT 241 318 2.2e-20 PFAM
low complexity region 320 338 N/A INTRINSIC
Alpha_adaptinC2 471 595 8.68e-39 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000124566
AA Change: H205N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115581
Gene: ENSMUSG00000030872
AA Change: H205N

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
VHS 29 162 2.45e-58 SMART
Pfam:GAT 225 326 1.3e-30 PFAM
Alpha_adaptinC2 471 595 8.68e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138441
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144779
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145277
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Golgi-localized, gamma adaptin ear-containing, ARF-binding (GGA) family. This family includes ubiquitous coat proteins that regulate the trafficking of proteins between the trans-Golgi network and the lysosome. These proteins share an amino-terminal VHS domain which mediates sorting of the mannose 6-phosphate receptors at the trans-Golgi network. They also contain a carboxy-terminal region with homology to the ear domain of gamma-adaptins. This family member may play a significant role in cargo molecules regulation and clathrin-coated vesicle assembly. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit complete embryonic lethality. Mice homozygous for a different gene trapped allele show decreased birth weight, hypoglycemia and partial neonatal lethality, with all remaining mice dying within the first three weeks of life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,191,973 H3R probably benign Het
Actg2 A T 6: 83,522,884 F128Y possibly damaging Het
Ankrd6 G A 4: 32,822,241 T176M probably damaging Het
Atp6ap1l T C 13: 90,898,707 D117G probably damaging Het
Cd209b A G 8: 3,918,714 I284T probably damaging Het
Cfl2 C T 12: 54,861,358 A123T probably benign Het
Cgnl1 T C 9: 71,724,540 T510A probably benign Het
Chn2 G T 6: 54,272,978 R24M probably damaging Het
Cyfip2 T C 11: 46,270,647 I339V probably benign Het
Etl4 C T 2: 20,744,075 P539L possibly damaging Het
Fras1 A G 5: 96,770,653 D3516G probably benign Het
Frem2 T C 3: 53,525,896 Y2669C probably damaging Het
Gm5592 G A 7: 41,289,067 G591D probably benign Het
Gtf3c1 A T 7: 125,647,450 C1562* probably null Het
Heatr3 T A 8: 88,138,311 C59S probably damaging Het
Heatr5b A G 17: 78,753,174 M2024T possibly damaging Het
Jarid2 T C 13: 44,902,256 S313P probably damaging Het
Lzts3 A G 2: 130,635,365 S502P probably damaging Het
Olfr1163 A G 2: 88,071,235 V49A probably benign Het
Pcdhb2 A T 18: 37,295,541 D189V probably damaging Het
Pias3 G T 3: 96,699,666 G82C probably damaging Het
Polg T C 7: 79,455,537 E753G probably damaging Het
Pus10 T C 11: 23,718,654 probably null Het
Pxn A G 5: 115,546,907 R264G probably damaging Het
Rag1 A G 2: 101,642,071 Y909H probably damaging Het
Rell2 A G 18: 37,958,214 H144R probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 C T 13: 11,587,437 V4520I possibly damaging Het
Scp2 A G 4: 108,063,984 F10L probably benign Het
Slc9b2 T C 3: 135,329,837 Y356H probably benign Het
Sorcs1 T C 19: 50,222,159 D756G probably benign Het
Stra6 T A 9: 58,151,218 V454E probably damaging Het
Tbc1d8 T C 1: 39,372,431 N1108S probably benign Het
Tep1 C T 14: 50,843,734 R1349Q possibly damaging Het
Tmem132d T C 5: 128,268,820 R213G probably benign Het
Ubash3a T C 17: 31,237,275 Y506H probably damaging Het
Xcr1 A C 9: 123,856,496 V67G probably damaging Het
Zranb2 C A 3: 157,537,590 C74* probably null Het
Other mutations in Gga2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01519:Gga2 APN 7 122002188 missense probably damaging 1.00
IGL01577:Gga2 APN 7 121989783 missense probably damaging 1.00
IGL01584:Gga2 APN 7 121991538 missense probably benign
IGL01671:Gga2 APN 7 121994856 missense probably benign 0.01
IGL01680:Gga2 APN 7 121998076 missense probably benign 0.06
IGL02745:Gga2 APN 7 122008369 missense probably damaging 1.00
R0122:Gga2 UTSW 7 121991574 missense probably damaging 1.00
R0218:Gga2 UTSW 7 121998900 missense possibly damaging 0.46
R1367:Gga2 UTSW 7 121998915 nonsense probably null
R1774:Gga2 UTSW 7 122012221 missense probably damaging 0.98
R4510:Gga2 UTSW 7 122021078 missense unknown
R6319:Gga2 UTSW 7 122002166 missense possibly damaging 0.92
R6395:Gga2 UTSW 7 122008438 splice site probably null
R6486:Gga2 UTSW 7 122002188 missense probably damaging 1.00
R6952:Gga2 UTSW 7 121998888 missense probably benign 0.00
R7035:Gga2 UTSW 7 121989716 missense probably damaging 1.00
R7320:Gga2 UTSW 7 122002103 missense probably benign
R7454:Gga2 UTSW 7 122002146 missense probably benign 0.00
R7593:Gga2 UTSW 7 121990449 missense probably benign 0.00
R7602:Gga2 UTSW 7 121997330 missense probably benign 0.05
R7638:Gga2 UTSW 7 122003934 missense probably damaging 1.00
R7736:Gga2 UTSW 7 121990524 missense probably damaging 1.00
R8032:Gga2 UTSW 7 122020987 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AATCACCATCCTGCTGGTCC -3'
(R):5'- TTAGAAACCAAGTCGTCTTTCCTG -3'

Sequencing Primer
(F):5'- TGGTCCCATTCAGCATGAG -3'
(R):5'- AAACCAAGTCGTCTTTCCTGATACTC -3'
Posted On2015-05-14