Incidental Mutation 'R4127:Cd209b'
ID315441
Institutional Source Beutler Lab
Gene Symbol Cd209b
Ensembl Gene ENSMUSG00000065987
Gene NameCD209b antigen
Synonyms1810030I22Rik, SIGNR1, mSIGNR1
MMRRC Submission 040860-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.047) question?
Stock #R4127 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location3917655-3926844 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3918714 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 284 (I284T)
Ref Sequence ENSEMBL: ENSMUSP00000126070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084086] [ENSMUST00000111014] [ENSMUST00000171635] [ENSMUST00000188386]
Predicted Effect probably damaging
Transcript: ENSMUST00000084086
AA Change: I314T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081104
Gene: ENSMUSG00000065987
AA Change: I314T

DomainStartEndE-ValueType
transmembrane domain 53 75 N/A INTRINSIC
low complexity region 91 102 N/A INTRINSIC
CLECT 195 316 3.63e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111014
SMART Domains Protein: ENSMUSP00000106643
Gene: ENSMUSG00000065987

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
CLECT 165 307 2.43e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171635
AA Change: I284T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126070
Gene: ENSMUSG00000065987
AA Change: I284T

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
CLECT 165 286 3.63e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000188386
AA Change: I305T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140695
Gene: ENSMUSG00000065987
AA Change: I305T

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
CLECT 165 307 2.43e-23 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutants are more susceptible to S. pneumoniae infection and fail to clear the bacteria from the circulation. Marginal zone and peritoneal macrophages are impaired in recognizing the bacteria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,191,973 H3R probably benign Het
Actg2 A T 6: 83,522,884 F128Y possibly damaging Het
Ankrd6 G A 4: 32,822,241 T176M probably damaging Het
Atp6ap1l T C 13: 90,898,707 D117G probably damaging Het
Cfl2 C T 12: 54,861,358 A123T probably benign Het
Cgnl1 T C 9: 71,724,540 T510A probably benign Het
Chn2 G T 6: 54,272,978 R24M probably damaging Het
Cyfip2 T C 11: 46,270,647 I339V probably benign Het
Etl4 C T 2: 20,744,075 P539L possibly damaging Het
Fras1 A G 5: 96,770,653 D3516G probably benign Het
Frem2 T C 3: 53,525,896 Y2669C probably damaging Het
Gga2 G T 7: 122,002,720 H205N probably damaging Het
Gm5592 G A 7: 41,289,067 G591D probably benign Het
Gtf3c1 A T 7: 125,647,450 C1562* probably null Het
Heatr3 T A 8: 88,138,311 C59S probably damaging Het
Heatr5b A G 17: 78,753,174 M2024T possibly damaging Het
Jarid2 T C 13: 44,902,256 S313P probably damaging Het
Lzts3 A G 2: 130,635,365 S502P probably damaging Het
Olfr1163 A G 2: 88,071,235 V49A probably benign Het
Pcdhb2 A T 18: 37,295,541 D189V probably damaging Het
Pias3 G T 3: 96,699,666 G82C probably damaging Het
Polg T C 7: 79,455,537 E753G probably damaging Het
Pus10 T C 11: 23,718,654 probably null Het
Pxn A G 5: 115,546,907 R264G probably damaging Het
Rag1 A G 2: 101,642,071 Y909H probably damaging Het
Rell2 A G 18: 37,958,214 H144R probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 C T 13: 11,587,437 V4520I possibly damaging Het
Scp2 A G 4: 108,063,984 F10L probably benign Het
Slc9b2 T C 3: 135,329,837 Y356H probably benign Het
Sorcs1 T C 19: 50,222,159 D756G probably benign Het
Stra6 T A 9: 58,151,218 V454E probably damaging Het
Tbc1d8 T C 1: 39,372,431 N1108S probably benign Het
Tep1 C T 14: 50,843,734 R1349Q possibly damaging Het
Tmem132d T C 5: 128,268,820 R213G probably benign Het
Ubash3a T C 17: 31,237,275 Y506H probably damaging Het
Xcr1 A C 9: 123,856,496 V67G probably damaging Het
Zranb2 C A 3: 157,537,590 C74* probably null Het
Other mutations in Cd209b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Cd209b APN 8 3919945 splice site probably benign
IGL01596:Cd209b APN 8 3918744 missense probably damaging 1.00
IGL03211:Cd209b APN 8 3918830 splice site probably benign
R1434:Cd209b UTSW 8 3923367 missense possibly damaging 0.49
R4387:Cd209b UTSW 8 3925960 missense probably damaging 0.99
R4388:Cd209b UTSW 8 3925960 missense probably damaging 0.99
R4389:Cd209b UTSW 8 3925960 missense probably damaging 0.99
R4708:Cd209b UTSW 8 3924215 missense probably damaging 0.99
R4710:Cd209b UTSW 8 3924215 missense probably damaging 0.99
R4911:Cd209b UTSW 8 3926640 critical splice acceptor site probably null
R5454:Cd209b UTSW 8 3925396 missense probably damaging 0.98
R5814:Cd209b UTSW 8 3923348 missense probably damaging 0.99
R5853:Cd209b UTSW 8 3926549 splice site probably null
R5867:Cd209b UTSW 8 3924246 missense possibly damaging 0.62
R5996:Cd209b UTSW 8 3918688 missense probably benign 0.39
R7020:Cd209b UTSW 8 3918783 missense probably damaging 0.99
R7187:Cd209b UTSW 8 3926638 missense probably benign
R7695:Cd209b UTSW 8 3926005 missense probably benign
R7712:Cd209b UTSW 8 3923299 missense possibly damaging 0.83
R7975:Cd209b UTSW 8 3925948 missense probably benign 0.41
R8309:Cd209b UTSW 8 3926559 nonsense probably null
R8317:Cd209b UTSW 8 3922018 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGACAATAGTGAGTCCCTTTGTG -3'
(R):5'- ATGGTTCACAGCATGCCAC -3'

Sequencing Primer
(F):5'- ATTTCCTAGGCAGGGGTCCTAAAC -3'
(R):5'- CACTGGAGCAGACTAACGTTTTTCTG -3'
Posted On2015-05-14