Incidental Mutation 'R4127:Heatr3'
ID315443
Institutional Source Beutler Lab
Gene Symbol Heatr3
Ensembl Gene ENSMUSG00000031657
Gene NameHEAT repeat containing 3
SynonymsC030036P15Rik
MMRRC Submission 040860-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.941) question?
Stock #R4127 (G1)
Quality Score216
Status Not validated
Chromosome8
Chromosomal Location88137855-88172027 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88138311 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 59 (C59S)
Ref Sequence ENSEMBL: ENSMUSP00000034079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034079] [ENSMUST00000095214] [ENSMUST00000121949] [ENSMUST00000127490]
Predicted Effect probably damaging
Transcript: ENSMUST00000034079
AA Change: C59S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034079
Gene: ENSMUSG00000031657
AA Change: C59S

DomainStartEndE-ValueType
Pfam:HEAT_EZ 41 106 2.5e-11 PFAM
Blast:ARM 111 171 2e-25 BLAST
Blast:ARM 172 215 1e-15 BLAST
low complexity region 357 366 N/A INTRINSIC
low complexity region 375 393 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000069786
Predicted Effect probably benign
Transcript: ENSMUST00000095214
SMART Domains Protein: ENSMUSP00000092839
Gene: ENSMUSG00000036810

DomainStartEndE-ValueType
Pfam:Tmemb_18A 5 122 1.6e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121949
SMART Domains Protein: ENSMUSP00000112812
Gene: ENSMUSG00000031657

DomainStartEndE-ValueType
Blast:ARM 1 54 7e-20 BLAST
Blast:ARM 55 98 8e-16 BLAST
low complexity region 240 249 N/A INTRINSIC
low complexity region 258 276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127490
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128290
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184847
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene plays a role in ribosomal protein transport and in the assembly of the 5S ribonucleoprotein particle (5S RNP). The encoded protein also may be involved in NOD2-mediated NF-kappaB signaling. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,191,973 H3R probably benign Het
Actg2 A T 6: 83,522,884 F128Y possibly damaging Het
Ankrd6 G A 4: 32,822,241 T176M probably damaging Het
Atp6ap1l T C 13: 90,898,707 D117G probably damaging Het
Cd209b A G 8: 3,918,714 I284T probably damaging Het
Cfl2 C T 12: 54,861,358 A123T probably benign Het
Cgnl1 T C 9: 71,724,540 T510A probably benign Het
Chn2 G T 6: 54,272,978 R24M probably damaging Het
Cyfip2 T C 11: 46,270,647 I339V probably benign Het
Etl4 C T 2: 20,744,075 P539L possibly damaging Het
Fras1 A G 5: 96,770,653 D3516G probably benign Het
Frem2 T C 3: 53,525,896 Y2669C probably damaging Het
Gga2 G T 7: 122,002,720 H205N probably damaging Het
Gm5592 G A 7: 41,289,067 G591D probably benign Het
Gtf3c1 A T 7: 125,647,450 C1562* probably null Het
Heatr5b A G 17: 78,753,174 M2024T possibly damaging Het
Jarid2 T C 13: 44,902,256 S313P probably damaging Het
Lzts3 A G 2: 130,635,365 S502P probably damaging Het
Olfr1163 A G 2: 88,071,235 V49A probably benign Het
Pcdhb2 A T 18: 37,295,541 D189V probably damaging Het
Pias3 G T 3: 96,699,666 G82C probably damaging Het
Polg T C 7: 79,455,537 E753G probably damaging Het
Pus10 T C 11: 23,718,654 probably null Het
Pxn A G 5: 115,546,907 R264G probably damaging Het
Rag1 A G 2: 101,642,071 Y909H probably damaging Het
Rell2 A G 18: 37,958,214 H144R probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 C T 13: 11,587,437 V4520I possibly damaging Het
Scp2 A G 4: 108,063,984 F10L probably benign Het
Slc9b2 T C 3: 135,329,837 Y356H probably benign Het
Sorcs1 T C 19: 50,222,159 D756G probably benign Het
Stra6 T A 9: 58,151,218 V454E probably damaging Het
Tbc1d8 T C 1: 39,372,431 N1108S probably benign Het
Tep1 C T 14: 50,843,734 R1349Q possibly damaging Het
Tmem132d T C 5: 128,268,820 R213G probably benign Het
Ubash3a T C 17: 31,237,275 Y506H probably damaging Het
Xcr1 A C 9: 123,856,496 V67G probably damaging Het
Zranb2 C A 3: 157,537,590 C74* probably null Het
Other mutations in Heatr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Heatr3 APN 8 88141739 missense possibly damaging 0.95
IGL00780:Heatr3 APN 8 88170940 missense probably benign 0.01
IGL01105:Heatr3 APN 8 88161893 missense probably benign 0.04
IGL01653:Heatr3 APN 8 88144617 missense probably benign
IGL02129:Heatr3 APN 8 88158271 splice site probably benign
IGL02145:Heatr3 APN 8 88144599 missense probably benign 0.40
IGL02177:Heatr3 APN 8 88156723 missense probably benign
IGL02309:Heatr3 APN 8 88167072 missense probably damaging 1.00
IGL02675:Heatr3 APN 8 88144557 missense possibly damaging 0.91
IGL03379:Heatr3 APN 8 88150110 missense probably benign 0.13
R0763:Heatr3 UTSW 8 88158241 missense probably damaging 1.00
R1244:Heatr3 UTSW 8 88141739 missense possibly damaging 0.95
R1883:Heatr3 UTSW 8 88144593 missense possibly damaging 0.95
R1988:Heatr3 UTSW 8 88150317 missense probably benign 0.02
R2043:Heatr3 UTSW 8 88147694 splice site probably benign
R2079:Heatr3 UTSW 8 88141776 missense probably damaging 0.99
R2402:Heatr3 UTSW 8 88144572 missense probably benign 0.33
R3916:Heatr3 UTSW 8 88150371 critical splice donor site probably null
R3917:Heatr3 UTSW 8 88150371 critical splice donor site probably null
R4182:Heatr3 UTSW 8 88171002 utr 3 prime probably benign
R4190:Heatr3 UTSW 8 88138260 unclassified probably benign
R4769:Heatr3 UTSW 8 88141783 critical splice donor site probably null
R6046:Heatr3 UTSW 8 88139954 missense probably damaging 1.00
R6073:Heatr3 UTSW 8 88138140 missense probably benign 0.01
R6888:Heatr3 UTSW 8 88170884 missense probably damaging 1.00
R7284:Heatr3 UTSW 8 88156774 missense possibly damaging 0.69
R8278:Heatr3 UTSW 8 88156733 missense possibly damaging 0.50
RF025:Heatr3 UTSW 8 88156456 critical splice acceptor site probably benign
RF031:Heatr3 UTSW 8 88156457 critical splice acceptor site probably benign
RF033:Heatr3 UTSW 8 88156456 critical splice acceptor site probably benign
RF040:Heatr3 UTSW 8 88156457 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- AGTTCTCCCCTATCGAGAGC -3'
(R):5'- TTGTTTGCTCGCAGGGACAC -3'

Sequencing Primer
(F):5'- TCCCCTATCGAGAGCTGTCAG -3'
(R):5'- AGGGACACTGCCTCGGG -3'
Posted On2015-05-14