Incidental Mutation 'R4127:Stra6'
ID315444
Institutional Source Beutler Lab
Gene Symbol Stra6
Ensembl Gene ENSMUSG00000032327
Gene Namestimulated by retinoic acid gene 6
Synonyms
MMRRC Submission 040860-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R4127 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location58063788-58153996 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58151218 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 454 (V454E)
Ref Sequence ENSEMBL: ENSMUSP00000130232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034880] [ENSMUST00000085677] [ENSMUST00000167479] [ENSMUST00000170397]
Predicted Effect probably damaging
Transcript: ENSMUST00000034880
AA Change: V454E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000034880
Gene: ENSMUSG00000032327
AA Change: V454E

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 659 1.6e-253 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000085677
AA Change: V454E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000082820
Gene: ENSMUSG00000032327
AA Change: V454E

DomainStartEndE-ValueType
Pfam:RBP_receptor 41 658 1.9e-248 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167479
AA Change: V454E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000128417
Gene: ENSMUSG00000032327
AA Change: V454E

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 659 1.6e-253 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170397
AA Change: V454E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000130232
Gene: ENSMUSG00000032327
AA Change: V454E

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 659 1.6e-253 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein involved in the metabolism of retinol. The encoded protein acts as a receptor for retinol/retinol binding protein complexes. This protein removes the retinol from the complex and transports it across the cell membrane. Defects in this gene are a cause of syndromic microphthalmia type 9 (MCOPS9). Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Male mice homozygous for a gene trap allele exhibit growth retardation. Mice homozygous for a knock-out allele exhibit persistent hyperplastic primary vitreous, shorter inner and outer segment and reduced rod and cone function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,191,973 H3R probably benign Het
Actg2 A T 6: 83,522,884 F128Y possibly damaging Het
Ankrd6 G A 4: 32,822,241 T176M probably damaging Het
Atp6ap1l T C 13: 90,898,707 D117G probably damaging Het
Cd209b A G 8: 3,918,714 I284T probably damaging Het
Cfl2 C T 12: 54,861,358 A123T probably benign Het
Cgnl1 T C 9: 71,724,540 T510A probably benign Het
Chn2 G T 6: 54,272,978 R24M probably damaging Het
Cyfip2 T C 11: 46,270,647 I339V probably benign Het
Etl4 C T 2: 20,744,075 P539L possibly damaging Het
Fras1 A G 5: 96,770,653 D3516G probably benign Het
Frem2 T C 3: 53,525,896 Y2669C probably damaging Het
Gga2 G T 7: 122,002,720 H205N probably damaging Het
Gm5592 G A 7: 41,289,067 G591D probably benign Het
Gtf3c1 A T 7: 125,647,450 C1562* probably null Het
Heatr3 T A 8: 88,138,311 C59S probably damaging Het
Heatr5b A G 17: 78,753,174 M2024T possibly damaging Het
Jarid2 T C 13: 44,902,256 S313P probably damaging Het
Lzts3 A G 2: 130,635,365 S502P probably damaging Het
Olfr1163 A G 2: 88,071,235 V49A probably benign Het
Pcdhb2 A T 18: 37,295,541 D189V probably damaging Het
Pias3 G T 3: 96,699,666 G82C probably damaging Het
Polg T C 7: 79,455,537 E753G probably damaging Het
Pus10 T C 11: 23,718,654 probably null Het
Pxn A G 5: 115,546,907 R264G probably damaging Het
Rag1 A G 2: 101,642,071 Y909H probably damaging Het
Rell2 A G 18: 37,958,214 H144R probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 C T 13: 11,587,437 V4520I possibly damaging Het
Scp2 A G 4: 108,063,984 F10L probably benign Het
Slc9b2 T C 3: 135,329,837 Y356H probably benign Het
Sorcs1 T C 19: 50,222,159 D756G probably benign Het
Tbc1d8 T C 1: 39,372,431 N1108S probably benign Het
Tep1 C T 14: 50,843,734 R1349Q possibly damaging Het
Tmem132d T C 5: 128,268,820 R213G probably benign Het
Ubash3a T C 17: 31,237,275 Y506H probably damaging Het
Xcr1 A C 9: 123,856,496 V67G probably damaging Het
Zranb2 C A 3: 157,537,590 C74* probably null Het
Other mutations in Stra6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Stra6 APN 9 58152571 missense probably benign 0.01
IGL01885:Stra6 APN 9 58141148 missense probably damaging 1.00
IGL02219:Stra6 APN 9 58140469 missense probably benign 0.18
IGL02550:Stra6 APN 9 58150083 missense possibly damaging 0.95
IGL02745:Stra6 APN 9 58152038 missense probably damaging 1.00
IGL02999:Stra6 APN 9 58135113 missense probably benign 0.19
R0034:Stra6 UTSW 9 58151469 splice site probably null
R0070:Stra6 UTSW 9 58152615 splice site probably benign
R0070:Stra6 UTSW 9 58152615 splice site probably benign
R0281:Stra6 UTSW 9 58145489 missense probably benign 0.11
R0387:Stra6 UTSW 9 58153183 missense probably benign 0.13
R0879:Stra6 UTSW 9 58135204 critical splice donor site probably null
R1075:Stra6 UTSW 9 58151404 missense possibly damaging 0.79
R1605:Stra6 UTSW 9 58151883 missense probably benign
R1840:Stra6 UTSW 9 58140530 missense probably benign 0.00
R1896:Stra6 UTSW 9 58151883 missense probably benign
R2149:Stra6 UTSW 9 58152539 missense probably benign 0.01
R4016:Stra6 UTSW 9 58135190 missense probably damaging 0.99
R4243:Stra6 UTSW 9 58143026 missense probably benign 0.06
R4631:Stra6 UTSW 9 58140832 intron probably benign
R4671:Stra6 UTSW 9 58149234 missense probably benign 0.01
R4688:Stra6 UTSW 9 58135076 critical splice acceptor site probably null
R5091:Stra6 UTSW 9 58141146 missense probably damaging 1.00
R6179:Stra6 UTSW 9 58135169 missense probably damaging 1.00
R6486:Stra6 UTSW 9 58151422 frame shift probably null
R6593:Stra6 UTSW 9 58151979 missense probably benign 0.00
R7368:Stra6 UTSW 9 58151260 missense probably benign 0.03
R7395:Stra6 UTSW 9 58141097 missense probably damaging 1.00
R7503:Stra6 UTSW 9 58151245 missense possibly damaging 0.70
R7807:Stra6 UTSW 9 58150161 missense probably damaging 0.97
R8099:Stra6 UTSW 9 58152494 missense probably damaging 1.00
R8377:Stra6 UTSW 9 58149205 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACAATCACATGGGGCTCC -3'
(R):5'- TTACAGCTAAGGCCACAGTCAG -3'

Sequencing Primer
(F):5'- GCCCTCAGAGTTAGGGACTACTATC -3'
(R):5'- CCACAGTCAGCCAGAAGGG -3'
Posted On2015-05-14