Incidental Mutation 'R4127:Xcr1'
ID315446
Institutional Source Beutler Lab
Gene Symbol Xcr1
Ensembl Gene ENSMUSG00000060509
Gene Namechemokine (C motif) receptor 1
SynonymsCcxcr1, XCR1, C motif-1/lymphotactin receptor, GPR5
MMRRC Submission 040860-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R4127 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location123852315-123862029 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 123856496 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 67 (V67G)
Ref Sequence ENSEMBL: ENSMUSP00000138255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084715] [ENSMUST00000167595] [ENSMUST00000182350] [ENSMUST00000184082]
Predicted Effect probably benign
Transcript: ENSMUST00000084715
SMART Domains Protein: ENSMUSP00000081764
Gene: ENSMUSG00000025241

DomainStartEndE-ValueType
Pfam:RUN 19 167 4.7e-12 PFAM
low complexity region 196 206 N/A INTRINSIC
coiled coil region 223 270 N/A INTRINSIC
coiled coil region 348 1110 N/A INTRINSIC
FYVE 1124 1191 2.69e-16 SMART
PDB:1OLM|E 1343 1428 1e-5 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000167595
SMART Domains Protein: ENSMUSP00000133222
Gene: ENSMUSG00000025241

DomainStartEndE-ValueType
Pfam:RUN 20 167 7.8e-12 PFAM
low complexity region 196 206 N/A INTRINSIC
coiled coil region 223 270 N/A INTRINSIC
coiled coil region 348 1110 N/A INTRINSIC
FYVE 1124 1191 2.69e-16 SMART
PDB:1OLM|E 1343 1428 1e-5 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000182350
AA Change: V67G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138255
Gene: ENSMUSG00000060509
AA Change: V67G

DomainStartEndE-ValueType
low complexity region 48 59 N/A INTRINSIC
Pfam:7tm_1 60 295 1.9e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183700
Predicted Effect probably benign
Transcript: ENSMUST00000184082
SMART Domains Protein: ENSMUSP00000139343
Gene: ENSMUSG00000025241

DomainStartEndE-ValueType
Pfam:RUN 7 167 4.5e-12 PFAM
low complexity region 196 206 N/A INTRINSIC
coiled coil region 223 270 N/A INTRINSIC
low complexity region 355 366 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a chemokine receptor belonging to the G protein-coupled receptor superfamily. The family members are characterized by the presence of 7 transmembrane domains and numerous conserved amino acids. This receptor is most closely related to RBS11 and the MIP1-alpha/RANTES receptor. It transduces a signal by increasing the intracellular calcium ions level. The viral macrophage inflammatory protein-II is an antagonist of this receptor and blocks signaling. Two alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit reduced CD8+ dendritic cell migration in response to XCL1. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,191,973 H3R probably benign Het
Actg2 A T 6: 83,522,884 F128Y possibly damaging Het
Ankrd6 G A 4: 32,822,241 T176M probably damaging Het
Atp6ap1l T C 13: 90,898,707 D117G probably damaging Het
Cd209b A G 8: 3,918,714 I284T probably damaging Het
Cfl2 C T 12: 54,861,358 A123T probably benign Het
Cgnl1 T C 9: 71,724,540 T510A probably benign Het
Chn2 G T 6: 54,272,978 R24M probably damaging Het
Cyfip2 T C 11: 46,270,647 I339V probably benign Het
Etl4 C T 2: 20,744,075 P539L possibly damaging Het
Fras1 A G 5: 96,770,653 D3516G probably benign Het
Frem2 T C 3: 53,525,896 Y2669C probably damaging Het
Gga2 G T 7: 122,002,720 H205N probably damaging Het
Gm5592 G A 7: 41,289,067 G591D probably benign Het
Gtf3c1 A T 7: 125,647,450 C1562* probably null Het
Heatr3 T A 8: 88,138,311 C59S probably damaging Het
Heatr5b A G 17: 78,753,174 M2024T possibly damaging Het
Jarid2 T C 13: 44,902,256 S313P probably damaging Het
Lzts3 A G 2: 130,635,365 S502P probably damaging Het
Olfr1163 A G 2: 88,071,235 V49A probably benign Het
Pcdhb2 A T 18: 37,295,541 D189V probably damaging Het
Pias3 G T 3: 96,699,666 G82C probably damaging Het
Polg T C 7: 79,455,537 E753G probably damaging Het
Pus10 T C 11: 23,718,654 probably null Het
Pxn A G 5: 115,546,907 R264G probably damaging Het
Rag1 A G 2: 101,642,071 Y909H probably damaging Het
Rell2 A G 18: 37,958,214 H144R probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 C T 13: 11,587,437 V4520I possibly damaging Het
Scp2 A G 4: 108,063,984 F10L probably benign Het
Slc9b2 T C 3: 135,329,837 Y356H probably benign Het
Sorcs1 T C 19: 50,222,159 D756G probably benign Het
Stra6 T A 9: 58,151,218 V454E probably damaging Het
Tbc1d8 T C 1: 39,372,431 N1108S probably benign Het
Tep1 C T 14: 50,843,734 R1349Q possibly damaging Het
Tmem132d T C 5: 128,268,820 R213G probably benign Het
Ubash3a T C 17: 31,237,275 Y506H probably damaging Het
Zranb2 C A 3: 157,537,590 C74* probably null Het
Other mutations in Xcr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03324:Xcr1 APN 9 123856484 missense probably benign 0.26
R0049:Xcr1 UTSW 9 123855875 missense possibly damaging 0.49
R0049:Xcr1 UTSW 9 123855875 missense possibly damaging 0.49
R0318:Xcr1 UTSW 9 123856154 missense possibly damaging 0.92
R0683:Xcr1 UTSW 9 123855875 missense probably benign 0.03
R4107:Xcr1 UTSW 9 123856088 missense possibly damaging 0.67
R4859:Xcr1 UTSW 9 123856647 missense probably benign
R5408:Xcr1 UTSW 9 123856566 missense probably benign 0.00
R5419:Xcr1 UTSW 9 123856310 missense probably benign 0.06
R5817:Xcr1 UTSW 9 123855857 missense possibly damaging 0.94
R6051:Xcr1 UTSW 9 123856116 missense probably benign 0.01
R6384:Xcr1 UTSW 9 123855782 missense probably damaging 1.00
R6395:Xcr1 UTSW 9 123855789 missense probably damaging 0.96
R6528:Xcr1 UTSW 9 123855983 missense probably damaging 1.00
R6594:Xcr1 UTSW 9 123856244 missense probably benign 0.00
R6990:Xcr1 UTSW 9 123856235 missense probably benign 0.15
R7648:Xcr1 UTSW 9 123856592 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- AGACAGGTATCGGTGGATGGTC -3'
(R):5'- GATGCTCTCAGTATCCCTGC -3'

Sequencing Primer
(F):5'- AAGATGCTGCTGTAGAGGCTG -3'
(R):5'- AGTATCCCTGCATCCCGCG -3'
Posted On2015-05-14