Incidental Mutation 'R4127:Atp6ap1l'
ID315453
Institutional Source Beutler Lab
Gene Symbol Atp6ap1l
Ensembl Gene ENSMUSG00000078958
Gene NameATPase, H+ transporting, lysosomal accessory protein 1-like
SynonymsEG435376
MMRRC Submission 040860-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R4127 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location90883433-90905355 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90898707 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 117 (D117G)
Ref Sequence ENSEMBL: ENSMUSP00000105168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109541] [ENSMUST00000182446]
Predicted Effect probably damaging
Transcript: ENSMUST00000109541
AA Change: D117G

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105168
Gene: ENSMUSG00000078958
AA Change: D117G

DomainStartEndE-ValueType
Pfam:Lamp 19 287 2.4e-12 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000182104
AA Change: D39G
Predicted Effect probably benign
Transcript: ENSMUST00000182446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182932
Predicted Effect unknown
Transcript: ENSMUST00000183162
AA Change: D79G
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,191,973 H3R probably benign Het
Actg2 A T 6: 83,522,884 F128Y possibly damaging Het
Ankrd6 G A 4: 32,822,241 T176M probably damaging Het
Cd209b A G 8: 3,918,714 I284T probably damaging Het
Cfl2 C T 12: 54,861,358 A123T probably benign Het
Cgnl1 T C 9: 71,724,540 T510A probably benign Het
Chn2 G T 6: 54,272,978 R24M probably damaging Het
Cyfip2 T C 11: 46,270,647 I339V probably benign Het
Etl4 C T 2: 20,744,075 P539L possibly damaging Het
Fras1 A G 5: 96,770,653 D3516G probably benign Het
Frem2 T C 3: 53,525,896 Y2669C probably damaging Het
Gga2 G T 7: 122,002,720 H205N probably damaging Het
Gm5592 G A 7: 41,289,067 G591D probably benign Het
Gtf3c1 A T 7: 125,647,450 C1562* probably null Het
Heatr3 T A 8: 88,138,311 C59S probably damaging Het
Heatr5b A G 17: 78,753,174 M2024T possibly damaging Het
Jarid2 T C 13: 44,902,256 S313P probably damaging Het
Lzts3 A G 2: 130,635,365 S502P probably damaging Het
Olfr1163 A G 2: 88,071,235 V49A probably benign Het
Pcdhb2 A T 18: 37,295,541 D189V probably damaging Het
Pias3 G T 3: 96,699,666 G82C probably damaging Het
Polg T C 7: 79,455,537 E753G probably damaging Het
Pus10 T C 11: 23,718,654 probably null Het
Pxn A G 5: 115,546,907 R264G probably damaging Het
Rag1 A G 2: 101,642,071 Y909H probably damaging Het
Rell2 A G 18: 37,958,214 H144R probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 C T 13: 11,587,437 V4520I possibly damaging Het
Scp2 A G 4: 108,063,984 F10L probably benign Het
Slc9b2 T C 3: 135,329,837 Y356H probably benign Het
Sorcs1 T C 19: 50,222,159 D756G probably benign Het
Stra6 T A 9: 58,151,218 V454E probably damaging Het
Tbc1d8 T C 1: 39,372,431 N1108S probably benign Het
Tep1 C T 14: 50,843,734 R1349Q possibly damaging Het
Tmem132d T C 5: 128,268,820 R213G probably benign Het
Ubash3a T C 17: 31,237,275 Y506H probably damaging Het
Xcr1 A C 9: 123,856,496 V67G probably damaging Het
Zranb2 C A 3: 157,537,590 C74* probably null Het
Other mutations in Atp6ap1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02823:Atp6ap1l APN 13 90899525 missense probably benign 0.00
R0545:Atp6ap1l UTSW 13 90883663 missense probably benign 0.03
R1224:Atp6ap1l UTSW 13 90886556 nonsense probably null
R1425:Atp6ap1l UTSW 13 90899519 missense possibly damaging 0.69
R1453:Atp6ap1l UTSW 13 90898747 missense probably benign 0.36
R1784:Atp6ap1l UTSW 13 90905281 missense probably damaging 0.96
R1853:Atp6ap1l UTSW 13 90883588 missense probably damaging 1.00
R1854:Atp6ap1l UTSW 13 90883588 missense probably damaging 1.00
R1932:Atp6ap1l UTSW 13 90883687 missense probably damaging 1.00
R5123:Atp6ap1l UTSW 13 90898898 intron probably benign
R5352:Atp6ap1l UTSW 13 90883756 missense probably damaging 1.00
R5746:Atp6ap1l UTSW 13 90883579 missense probably benign
R6492:Atp6ap1l UTSW 13 90883722 missense probably damaging 1.00
R6687:Atp6ap1l UTSW 13 90886723 missense probably benign 0.09
R7150:Atp6ap1l UTSW 13 90883729 missense probably damaging 1.00
R7358:Atp6ap1l UTSW 13 90883807 missense probably damaging 1.00
R7595:Atp6ap1l UTSW 13 90891016 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTTTCACTTTTAAAGCCTACAGA -3'
(R):5'- TCCAAGGACACAAATTTGTCTCTAA -3'

Sequencing Primer
(F):5'- GCTCAGACAAAATGTGCTTGTTGAG -3'
(R):5'- AGCCATCACAACCCTGTT -3'
Posted On2015-05-14