Incidental Mutation 'R4128:Ireb2'
ID315478
Institutional Source Beutler Lab
Gene Symbol Ireb2
Ensembl Gene ENSMUSG00000032293
Gene Nameiron responsive element binding protein 2
SynonymsD9Ertd85e, Irp2
MMRRC Submission 041635-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4128 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location54863789-54912530 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 54881432 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 63 (D63E)
Ref Sequence ENSEMBL: ENSMUSP00000034843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034843]
Predicted Effect probably benign
Transcript: ENSMUST00000034843
AA Change: D63E

PolyPhen 2 Score 0.324 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000034843
Gene: ENSMUSG00000032293
AA Change: D63E

DomainStartEndE-ValueType
Pfam:Aconitase 59 155 6.5e-16 PFAM
Pfam:Aconitase 186 639 2e-129 PFAM
Pfam:Aconitase_C 767 896 1.5e-44 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous disruption of this gene results in microcytic anemia, altered body iron homeostasis, and variable behavioral and neurological phenotypes that may include pathological signs of neurodegeneration or brain iron accumulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl4 C T 3: 95,681,672 R483Q probably benign Het
Bbox1 A G 2: 110,270,180 V224A probably benign Het
Cavin2 A G 1: 51,301,422 *419W probably null Het
Cdk19 A G 10: 40,394,395 I67V probably benign Het
Cds2 A G 2: 132,297,271 T145A probably benign Het
Chn2 G T 6: 54,272,978 R24M probably damaging Het
Csl T C 10: 99,758,600 D201G probably benign Het
Erap1 T C 13: 74,666,196 I33T probably damaging Het
Ermap T C 4: 119,187,111 T163A possibly damaging Het
Gnas A G 2: 174,300,165 N709S possibly damaging Het
Hsd17b14 G A 7: 45,563,008 V155M probably damaging Het
Igf2bp2 C T 16: 22,078,621 V281I probably benign Het
Ighj4 T C 12: 113,428,556 probably benign Het
Jarid2 T C 13: 44,902,256 S313P probably damaging Het
Kcnj11 A G 7: 46,099,719 F60S probably damaging Het
Lyplal1 A G 1: 186,089,539 C129R possibly damaging Het
Mertk C T 2: 128,777,438 Q539* probably null Het
Myrip C A 9: 120,464,698 S753* probably null Het
Narf G A 11: 121,250,435 probably null Het
Neb C A 2: 52,292,700 L1051F probably damaging Het
Nid1 T C 13: 13,476,372 V498A probably damaging Het
Olfr509 T C 7: 108,646,426 N50S probably benign Het
Olfr761 A G 17: 37,952,790 I78T probably benign Het
Pam A G 1: 97,834,468 Y691H probably damaging Het
Poln A G 5: 34,103,951 S561P probably benign Het
Rab39 T A 9: 53,686,504 I154L probably benign Het
Rnf187 A T 11: 58,934,057 S220T probably benign Het
Stac C A 9: 111,604,058 probably null Het
Stxbp3 T C 3: 108,794,831 Q553R probably benign Het
Tmem179 A T 12: 112,511,027 F8I possibly damaging Het
Trip11 G A 12: 101,895,698 Q203* probably null Het
Ubash3a T C 17: 31,237,275 Y506H probably damaging Het
Unc13c C A 9: 73,734,537 A1225S probably damaging Het
Zranb1 C A 7: 132,966,552 S313* probably null Het
Other mutations in Ireb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Ireb2 APN 9 54899482 splice site probably benign
IGL01576:Ireb2 APN 9 54892510 missense probably damaging 1.00
IGL01844:Ireb2 APN 9 54865357 missense probably benign 0.01
bonkers UTSW 9 54896495 missense probably benign 0.00
homicidal UTSW 9 54886567 nonsense probably null
remorseless UTSW 9 54882333 missense possibly damaging 0.83
tony_stark UTSW 9 54903961 missense probably damaging 1.00
R0143:Ireb2 UTSW 9 54885909 missense probably benign 0.06
R0279:Ireb2 UTSW 9 54886593 missense probably benign
R0400:Ireb2 UTSW 9 54896498 missense probably benign
R0565:Ireb2 UTSW 9 54899983 missense probably damaging 1.00
R0686:Ireb2 UTSW 9 54904176 missense probably benign 0.44
R0706:Ireb2 UTSW 9 54892486 missense probably benign
R0894:Ireb2 UTSW 9 54896577 missense probably damaging 1.00
R1101:Ireb2 UTSW 9 54909702 missense probably benign 0.35
R1680:Ireb2 UTSW 9 54881518 missense probably damaging 1.00
R2074:Ireb2 UTSW 9 54881449 missense probably benign
R2080:Ireb2 UTSW 9 54896552 missense possibly damaging 0.85
R2891:Ireb2 UTSW 9 54899990 missense probably benign 0.01
R3153:Ireb2 UTSW 9 54885946 critical splice donor site probably null
R3154:Ireb2 UTSW 9 54885946 critical splice donor site probably null
R3844:Ireb2 UTSW 9 54892505 missense probably damaging 0.99
R4803:Ireb2 UTSW 9 54906814 missense probably benign 0.01
R5097:Ireb2 UTSW 9 54895384 missense probably benign 0.04
R5159:Ireb2 UTSW 9 54892547 missense probably benign
R5227:Ireb2 UTSW 9 54896601 critical splice donor site probably null
R5767:Ireb2 UTSW 9 54900516 missense probably benign
R6005:Ireb2 UTSW 9 54908805 missense probably damaging 1.00
R6127:Ireb2 UTSW 9 54882368 missense probably benign
R6155:Ireb2 UTSW 9 54886527 missense probably damaging 1.00
R6170:Ireb2 UTSW 9 54887372 missense probably benign 0.00
R6341:Ireb2 UTSW 9 54908780 missense probably damaging 0.99
R6707:Ireb2 UTSW 9 54903961 missense probably damaging 1.00
R6973:Ireb2 UTSW 9 54882387 missense probably benign 0.00
R7108:Ireb2 UTSW 9 54906641 missense probably damaging 1.00
R7126:Ireb2 UTSW 9 54886567 nonsense probably null
R7314:Ireb2 UTSW 9 54892510 missense probably damaging 1.00
R7396:Ireb2 UTSW 9 54882333 missense possibly damaging 0.83
R7472:Ireb2 UTSW 9 54884054 missense probably benign 0.11
R7590:Ireb2 UTSW 9 54896495 missense probably benign 0.00
R7842:Ireb2 UTSW 9 54909686 missense probably benign 0.01
R7894:Ireb2 UTSW 9 54882336 missense probably damaging 1.00
R8443:Ireb2 UTSW 9 54903981 missense possibly damaging 0.94
RF006:Ireb2 UTSW 9 54881484 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TCCAACATTGCAATGAGAGAAAA -3'
(R):5'- AAGGCGATATATGTGGAGGAATTAAT -3'

Sequencing Primer
(F):5'- TGTCCACAGTGGGCTAAATC -3'
(R):5'- TGCTGTCACTCACGTGAA -3'
Posted On2015-05-14