Incidental Mutation 'R4128:Csl'
ID315483
Institutional Source Beutler Lab
Gene Symbol Csl
Ensembl Gene ENSMUSG00000046934
Gene Namecitrate synthase like
Synonyms
MMRRC Submission 041635-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.566) question?
Stock #R4128 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location99757706-99759658 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99758600 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 201 (D201G)
Ref Sequence ENSEMBL: ENSMUSP00000052373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056085]
PDB Structure Substrate induced remodeling of the active site regulates HtrA1 activity [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000056085
AA Change: D201G

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000052373
Gene: ENSMUSG00000046934
AA Change: D201G

DomainStartEndE-ValueType
Pfam:Citrate_synt 71 449 6.2e-119 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217945
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222959
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl4 C T 3: 95,681,672 R483Q probably benign Het
Bbox1 A G 2: 110,270,180 V224A probably benign Het
Cavin2 A G 1: 51,301,422 *419W probably null Het
Cdk19 A G 10: 40,394,395 I67V probably benign Het
Cds2 A G 2: 132,297,271 T145A probably benign Het
Chn2 G T 6: 54,272,978 R24M probably damaging Het
Erap1 T C 13: 74,666,196 I33T probably damaging Het
Ermap T C 4: 119,187,111 T163A possibly damaging Het
Gnas A G 2: 174,300,165 N709S possibly damaging Het
Hsd17b14 G A 7: 45,563,008 V155M probably damaging Het
Igf2bp2 C T 16: 22,078,621 V281I probably benign Het
Ighj4 T C 12: 113,428,556 probably benign Het
Ireb2 T A 9: 54,881,432 D63E probably benign Het
Jarid2 T C 13: 44,902,256 S313P probably damaging Het
Kcnj11 A G 7: 46,099,719 F60S probably damaging Het
Lyplal1 A G 1: 186,089,539 C129R possibly damaging Het
Mertk C T 2: 128,777,438 Q539* probably null Het
Myrip C A 9: 120,464,698 S753* probably null Het
Narf G A 11: 121,250,435 probably null Het
Neb C A 2: 52,292,700 L1051F probably damaging Het
Nid1 T C 13: 13,476,372 V498A probably damaging Het
Olfr509 T C 7: 108,646,426 N50S probably benign Het
Olfr761 A G 17: 37,952,790 I78T probably benign Het
Pam A G 1: 97,834,468 Y691H probably damaging Het
Poln A G 5: 34,103,951 S561P probably benign Het
Rab39 T A 9: 53,686,504 I154L probably benign Het
Rnf187 A T 11: 58,934,057 S220T probably benign Het
Stac C A 9: 111,604,058 probably null Het
Stxbp3 T C 3: 108,794,831 Q553R probably benign Het
Tmem179 A T 12: 112,511,027 F8I possibly damaging Het
Trip11 G A 12: 101,895,698 Q203* probably null Het
Ubash3a T C 17: 31,237,275 Y506H probably damaging Het
Unc13c C A 9: 73,734,537 A1225S probably damaging Het
Zranb1 C A 7: 132,966,552 S313* probably null Het
Other mutations in Csl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02523:Csl APN 10 99758813 missense probably benign 0.39
R1519:Csl UTSW 10 99757955 missense probably damaging 1.00
R2284:Csl UTSW 10 99758459 missense possibly damaging 0.84
R2882:Csl UTSW 10 99758925 missense probably damaging 1.00
R4424:Csl UTSW 10 99758591 missense possibly damaging 0.82
R4819:Csl UTSW 10 99758082 missense possibly damaging 0.81
R4876:Csl UTSW 10 99758540 missense possibly damaging 0.93
R5700:Csl UTSW 10 99759015 missense probably damaging 0.97
R6463:Csl UTSW 10 99759098 missense probably damaging 0.99
R8064:Csl UTSW 10 99758545 missense probably damaging 1.00
R8161:Csl UTSW 10 99758320 missense probably damaging 1.00
R8296:Csl UTSW 10 99758299 missense probably damaging 1.00
R8317:Csl UTSW 10 99759038 missense probably damaging 1.00
R8696:Csl UTSW 10 99758964 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACAAACGCATGAGCTCGGTG -3'
(R):5'- AACTGGACAGATGCCCACAG -3'

Sequencing Primer
(F):5'- GCATGAGCTCGGTGAACTG -3'
(R):5'- AGGAACAGGTATCTTGGCTCTCAC -3'
Posted On2015-05-14