Incidental Mutation 'R4128:Tmem179'
ID315487
Institutional Source Beutler Lab
Gene Symbol Tmem179
Ensembl Gene ENSMUSG00000054013
Gene Nametransmembrane protein 179
Synonyms
MMRRC Submission 041635-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R4128 (G1)
Quality Score208
Status Not validated
Chromosome12
Chromosomal Location112500189-112516747 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 112511027 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 8 (F8I)
Ref Sequence ENSEMBL: ENSMUSP00000068004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066791] [ENSMUST00000222836]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066791
AA Change: F8I

PolyPhen 2 Score 0.710 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000068004
Gene: ENSMUSG00000054013
AA Change: F8I

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 73 95 N/A INTRINSIC
transmembrane domain 102 124 N/A INTRINSIC
transmembrane domain 171 193 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000222836
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl4 C T 3: 95,681,672 R483Q probably benign Het
Bbox1 A G 2: 110,270,180 V224A probably benign Het
Cavin2 A G 1: 51,301,422 *419W probably null Het
Cdk19 A G 10: 40,394,395 I67V probably benign Het
Cds2 A G 2: 132,297,271 T145A probably benign Het
Chn2 G T 6: 54,272,978 R24M probably damaging Het
Csl T C 10: 99,758,600 D201G probably benign Het
Erap1 T C 13: 74,666,196 I33T probably damaging Het
Ermap T C 4: 119,187,111 T163A possibly damaging Het
Gnas A G 2: 174,300,165 N709S possibly damaging Het
Hsd17b14 G A 7: 45,563,008 V155M probably damaging Het
Igf2bp2 C T 16: 22,078,621 V281I probably benign Het
Ighj4 T C 12: 113,428,556 probably benign Het
Ireb2 T A 9: 54,881,432 D63E probably benign Het
Jarid2 T C 13: 44,902,256 S313P probably damaging Het
Kcnj11 A G 7: 46,099,719 F60S probably damaging Het
Lyplal1 A G 1: 186,089,539 C129R possibly damaging Het
Mertk C T 2: 128,777,438 Q539* probably null Het
Myrip C A 9: 120,464,698 S753* probably null Het
Narf G A 11: 121,250,435 probably null Het
Neb C A 2: 52,292,700 L1051F probably damaging Het
Nid1 T C 13: 13,476,372 V498A probably damaging Het
Olfr509 T C 7: 108,646,426 N50S probably benign Het
Olfr761 A G 17: 37,952,790 I78T probably benign Het
Pam A G 1: 97,834,468 Y691H probably damaging Het
Poln A G 5: 34,103,951 S561P probably benign Het
Rab39 T A 9: 53,686,504 I154L probably benign Het
Rnf187 A T 11: 58,934,057 S220T probably benign Het
Stac C A 9: 111,604,058 probably null Het
Stxbp3 T C 3: 108,794,831 Q553R probably benign Het
Trip11 G A 12: 101,895,698 Q203* probably null Het
Ubash3a T C 17: 31,237,275 Y506H probably damaging Het
Unc13c C A 9: 73,734,537 A1225S probably damaging Het
Zranb1 C A 7: 132,966,552 S313* probably null Het
Other mutations in Tmem179
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1470:Tmem179 UTSW 12 112501854 missense probably benign 0.05
R1470:Tmem179 UTSW 12 112501854 missense probably benign 0.05
R1553:Tmem179 UTSW 12 112504660 missense probably benign
R2405:Tmem179 UTSW 12 112501913 missense probably damaging 1.00
R4125:Tmem179 UTSW 12 112511027 missense possibly damaging 0.71
R4480:Tmem179 UTSW 12 112503303 missense probably benign
R4916:Tmem179 UTSW 12 112501834 missense probably damaging 1.00
R6682:Tmem179 UTSW 12 112503280 missense probably benign 0.25
R7636:Tmem179 UTSW 12 112510743 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGGCCTAAACTTACCCCTCG -3'
(R):5'- CCACCAATGCAGTCTGTCTAG -3'

Sequencing Primer
(F):5'- TCGTGTCCCTTGCAGAGG -3'
(R):5'- CACCAATGCAGTCTGTCTAGTGTAG -3'
Posted On2015-05-14