Mutagenetix > Incidental Mutation

Incidental Mutation 'R4128:Nid1'

315489

Institutional Source

Beutler Lab

Gene Symbol

Nid1

Ensembl Gene

ENSMUSG00000005397

Gene Name

nidogen 1

Synonyms

entactin 1, nidogen-1, entactin, entactin-1

MMRRC Submission

041635-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.244) question?

Stock #

R4128 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

13437551-13512269 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 13476372 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 498 (V498A)

Ref Sequence

ENSEMBL: ENSMUSP00000005532 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005532]

AlphaFold

P10493

PDB Structure

NIDOGEN-1 G2/PERLECAN IG3 COMPLEX [X-RAY DIFFRACTION]
DOMAIN G2 OF MOUSE NIDOGEN-1 [X-RAY DIFFRACTION]
Crystal structure of Nidogen/Laminin Complex [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000005532
AA Change: V498A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000005532
Gene: ENSMUSG00000005397
AA Change: V498A

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
NIDO	106	270	3.8e-70	SMART
low complexity region	277	296	N/A	INTRINSIC
EGF	387	424	3.46e0	SMART
G2F	425	664	7.69e-153	SMART
EGF	669	707	8.65e-1	SMART
EGF_CA	708	749	4.38e-11	SMART
EGF	759	799	8.19e-2	SMART
EGF_CA	800	838	1.42e-10	SMART
TY	873	921	1.17e-19	SMART
LY	968	1010	1.35e-2	SMART
LY	1011	1053	4.34e-15	SMART
LY	1054	1098	3.34e-16	SMART
LY	1099	1141	3.25e-5	SMART
LY	1142	1181	1.08e1	SMART
EGF	1209	1242	2.45e0	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220813

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222142

Meta Mutation Damage Score

0.3502

Coding Region Coverage

1x: 99.4%
3x: 98.6%
10x: 97.1%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nidogen family of basement membrane glycoproteins. The protein interacts with several other components of basement membranes, and may play a role in cell interactions with the extracellular matrix. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neurologic deficits including seizure-like symptoms and loss of muscle control in the hind legs, and show altered basement membrane morphology in selected locations including brain capillaries and the lens capsule. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamtsl4	C	T	3: 95,681,672	R483Q	probably benign	Het
Bbox1	A	G	2: 110,270,180	V224A	probably benign	Het
Cavin2	A	G	1: 51,301,422	*419W	probably null	Het
Cdk19	A	G	10: 40,394,395	I67V	probably benign	Het
Cds2	A	G	2: 132,297,271	T145A	probably benign	Het
Chn2	G	T	6: 54,272,978	R24M	probably damaging	Het
Csl	T	C	10: 99,758,600	D201G	probably benign	Het
Erap1	T	C	13: 74,666,196	I33T	probably damaging	Het
Ermap	T	C	4: 119,187,111	T163A	possibly damaging	Het
Gnas	A	G	2: 174,300,165	N709S	possibly damaging	Het
Hsd17b14	G	A	7: 45,563,008	V155M	probably damaging	Het
Igf2bp2	C	T	16: 22,078,621	V281I	probably benign	Het
Ighj4	T	C	12: 113,428,556		probably benign	Het
Ireb2	T	A	9: 54,881,432	D63E	probably benign	Het
Jarid2	T	C	13: 44,902,256	S313P	probably damaging	Het
Kcnj11	A	G	7: 46,099,719	F60S	probably damaging	Het
Lyplal1	A	G	1: 186,089,539	C129R	possibly damaging	Het
Mertk	C	T	2: 128,777,438	Q539*	probably null	Het
Myrip	C	A	9: 120,464,698	S753*	probably null	Het
Narf	G	A	11: 121,250,435		probably null	Het
Neb	C	A	2: 52,292,700	L1051F	probably damaging	Het
Olfr509	T	C	7: 108,646,426	N50S	probably benign	Het
Olfr761	A	G	17: 37,952,790	I78T	probably benign	Het
Pam	A	G	1: 97,834,468	Y691H	probably damaging	Het
Poln	A	G	5: 34,103,951	S561P	probably benign	Het
Rab39	T	A	9: 53,686,504	I154L	probably benign	Het
Rnf187	A	T	11: 58,934,057	S220T	probably benign	Het
Stac	C	A	9: 111,604,058		probably null	Het
Stxbp3	T	C	3: 108,794,831	Q553R	probably benign	Het
Tmem179	A	T	12: 112,511,027	F8I	possibly damaging	Het
Trip11	G	A	12: 101,895,698	Q203*	probably null	Het
Ubash3a	T	C	17: 31,237,275	Y506H	probably damaging	Het
Unc13c	C	A	9: 73,734,537	A1225S	probably damaging	Het
Zranb1	C	A	7: 132,966,552	S313*	probably null	Het

Other mutations in Nid1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Nid1	APN	13	13476392	missense	probably damaging	1.00
IGL02126:Nid1	APN	13	13489158	splice site	probably null
IGL02452:Nid1	APN	13	13508720	missense	probably benign	0.17
IGL02806:Nid1	APN	13	13468312	missense	probably benign	0.00
IGL02966:Nid1	APN	13	13482221	missense	probably benign	0.09
IGL03136:Nid1	APN	13	13500499	missense	probably benign	0.33
IGL03411:Nid1	APN	13	13437889	missense	probably damaging	0.98
R0384:Nid1	UTSW	13	13463836	missense	probably benign	0.34
R0413:Nid1	UTSW	13	13482096	missense	probably benign	0.01
R1257:Nid1	UTSW	13	13483790	missense	probably benign	0.01
R1390:Nid1	UTSW	13	13476246	missense	probably damaging	1.00
R1397:Nid1	UTSW	13	13508795	missense	possibly damaging	0.94
R2057:Nid1	UTSW	13	13500473	missense	probably benign	0.00
R2058:Nid1	UTSW	13	13500473	missense	probably benign	0.00
R2059:Nid1	UTSW	13	13500473	missense	probably benign	0.00
R2132:Nid1	UTSW	13	13509486	missense	probably benign	0.04
R2140:Nid1	UTSW	13	13499668	missense	probably damaging	1.00
R2195:Nid1	UTSW	13	13476203	missense	probably damaging	1.00
R2237:Nid1	UTSW	13	13500485	missense	probably benign
R2312:Nid1	UTSW	13	13500493	missense	probably benign	0.15
R2987:Nid1	UTSW	13	13499673	missense	probably benign	0.40
R3696:Nid1	UTSW	13	13486759	missense	probably damaging	0.99
R3697:Nid1	UTSW	13	13486759	missense	probably damaging	0.99
R3698:Nid1	UTSW	13	13486759	missense	probably damaging	0.99
R3772:Nid1	UTSW	13	13476418	splice site	probably benign
R4092:Nid1	UTSW	13	13486639	missense	probably damaging	0.96
R4126:Nid1	UTSW	13	13476372	missense	probably damaging	1.00
R4680:Nid1	UTSW	13	13472852	missense	probably damaging	1.00
R4717:Nid1	UTSW	13	13506501	missense	probably benign	0.00
R4783:Nid1	UTSW	13	13499741	missense	probably damaging	0.97
R4812:Nid1	UTSW	13	13506468	nonsense	probably null
R4834:Nid1	UTSW	13	13508823	missense	probably damaging	1.00
R4915:Nid1	UTSW	13	13499586	missense	possibly damaging	0.89
R4930:Nid1	UTSW	13	13510011	missense	probably damaging	1.00
R5101:Nid1	UTSW	13	13483754	missense	probably damaging	1.00
R5276:Nid1	UTSW	13	13468572	missense	probably damaging	0.99
R5427:Nid1	UTSW	13	13483683	missense	probably damaging	1.00
R5447:Nid1	UTSW	13	13437910	missense	probably benign	0.00
R5507:Nid1	UTSW	13	13489037	nonsense	probably null
R5663:Nid1	UTSW	13	13472834	missense	probably damaging	1.00
R5868:Nid1	UTSW	13	13489157	critical splice donor site	probably null
R6313:Nid1	UTSW	13	13463782	missense	probably benign	0.01
R6761:Nid1	UTSW	13	13482035	missense	probably benign	0.22
R7069:Nid1	UTSW	13	13508768	missense	probably benign
R7208:Nid1	UTSW	13	13468385	missense	probably benign	0.01
R7284:Nid1	UTSW	13	13489090	missense	probably benign	0.01
R7434:Nid1	UTSW	13	13468464	missense	probably benign
R7449:Nid1	UTSW	13	13482051	missense	probably damaging	1.00
R7574:Nid1	UTSW	13	13468443	missense	probably benign
R7762:Nid1	UTSW	13	13489045	missense	probably damaging	1.00
R7887:Nid1	UTSW	13	13499733	missense	possibly damaging	0.83
R8420:Nid1	UTSW	13	13437831	missense	possibly damaging	0.81
R8506:Nid1	UTSW	13	13476174	missense	probably damaging	0.99
R8756:Nid1	UTSW	13	13508801	missense	probably benign	0.32
R8903:Nid1	UTSW	13	13463930	missense	probably benign	0.00
R9084:Nid1	UTSW	13	13478340	critical splice donor site	probably null
R9297:Nid1	UTSW	13	13476312	missense	possibly damaging	0.92
R9344:Nid1	UTSW	13	13478309	missense	probably damaging	1.00
R9552:Nid1	UTSW	13	13502460	missense	probably damaging	0.99
X0028:Nid1	UTSW	13	13509534	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- CACAACGGGTCAATGGCAAG -3'
(R):5'- TCTCCTGGTCCTTATTTCTGAGGAAG -3'

Sequencing Primer
(F):5'- TGAAGGGAAGGATCTTCGTGG -3'
(R):5'- AAGAACTAGAGGGCCCCTGTC -3'

Posted On

2015-05-14