Incidental Mutation 'R4128:Nid1'
ID315489
Institutional Source Beutler Lab
Gene Symbol Nid1
Ensembl Gene ENSMUSG00000005397
Gene Namenidogen 1
Synonymsentactin 1, nidogen-1, entactin, entactin-1
MMRRC Submission 041635-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #R4128 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location13437551-13512269 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13476372 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 498 (V498A)
Ref Sequence ENSEMBL: ENSMUSP00000005532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005532]
PDB Structure NIDOGEN-1 G2/PERLECAN IG3 COMPLEX [X-RAY DIFFRACTION]
DOMAIN G2 OF MOUSE NIDOGEN-1 [X-RAY DIFFRACTION]
Crystal structure of Nidogen/Laminin Complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000005532
AA Change: V498A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000005532
Gene: ENSMUSG00000005397
AA Change: V498A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
NIDO 106 270 3.8e-70 SMART
low complexity region 277 296 N/A INTRINSIC
EGF 387 424 3.46e0 SMART
G2F 425 664 7.69e-153 SMART
EGF 669 707 8.65e-1 SMART
EGF_CA 708 749 4.38e-11 SMART
EGF 759 799 8.19e-2 SMART
EGF_CA 800 838 1.42e-10 SMART
TY 873 921 1.17e-19 SMART
LY 968 1010 1.35e-2 SMART
LY 1011 1053 4.34e-15 SMART
LY 1054 1098 3.34e-16 SMART
LY 1099 1141 3.25e-5 SMART
LY 1142 1181 1.08e1 SMART
EGF 1209 1242 2.45e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220813
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222142
Meta Mutation Damage Score 0.3502 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nidogen family of basement membrane glycoproteins. The protein interacts with several other components of basement membranes, and may play a role in cell interactions with the extracellular matrix. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neurologic deficits including seizure-like symptoms and loss of muscle control in the hind legs, and show altered basement membrane morphology in selected locations including brain capillaries and the lens capsule. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl4 C T 3: 95,681,672 R483Q probably benign Het
Bbox1 A G 2: 110,270,180 V224A probably benign Het
Cavin2 A G 1: 51,301,422 *419W probably null Het
Cdk19 A G 10: 40,394,395 I67V probably benign Het
Cds2 A G 2: 132,297,271 T145A probably benign Het
Chn2 G T 6: 54,272,978 R24M probably damaging Het
Csl T C 10: 99,758,600 D201G probably benign Het
Erap1 T C 13: 74,666,196 I33T probably damaging Het
Ermap T C 4: 119,187,111 T163A possibly damaging Het
Gnas A G 2: 174,300,165 N709S possibly damaging Het
Hsd17b14 G A 7: 45,563,008 V155M probably damaging Het
Igf2bp2 C T 16: 22,078,621 V281I probably benign Het
Ighj4 T C 12: 113,428,556 probably benign Het
Ireb2 T A 9: 54,881,432 D63E probably benign Het
Jarid2 T C 13: 44,902,256 S313P probably damaging Het
Kcnj11 A G 7: 46,099,719 F60S probably damaging Het
Lyplal1 A G 1: 186,089,539 C129R possibly damaging Het
Mertk C T 2: 128,777,438 Q539* probably null Het
Myrip C A 9: 120,464,698 S753* probably null Het
Narf G A 11: 121,250,435 probably null Het
Neb C A 2: 52,292,700 L1051F probably damaging Het
Olfr509 T C 7: 108,646,426 N50S probably benign Het
Olfr761 A G 17: 37,952,790 I78T probably benign Het
Pam A G 1: 97,834,468 Y691H probably damaging Het
Poln A G 5: 34,103,951 S561P probably benign Het
Rab39 T A 9: 53,686,504 I154L probably benign Het
Rnf187 A T 11: 58,934,057 S220T probably benign Het
Stac C A 9: 111,604,058 probably null Het
Stxbp3 T C 3: 108,794,831 Q553R probably benign Het
Tmem179 A T 12: 112,511,027 F8I possibly damaging Het
Trip11 G A 12: 101,895,698 Q203* probably null Het
Ubash3a T C 17: 31,237,275 Y506H probably damaging Het
Unc13c C A 9: 73,734,537 A1225S probably damaging Het
Zranb1 C A 7: 132,966,552 S313* probably null Het
Other mutations in Nid1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Nid1 APN 13 13476392 missense probably damaging 1.00
IGL02126:Nid1 APN 13 13489158 splice site probably null
IGL02452:Nid1 APN 13 13508720 missense probably benign 0.17
IGL02806:Nid1 APN 13 13468312 missense probably benign 0.00
IGL02966:Nid1 APN 13 13482221 missense probably benign 0.09
IGL03136:Nid1 APN 13 13500499 missense probably benign 0.33
IGL03411:Nid1 APN 13 13437889 missense probably damaging 0.98
R0384:Nid1 UTSW 13 13463836 missense probably benign 0.34
R0413:Nid1 UTSW 13 13482096 missense probably benign 0.01
R1257:Nid1 UTSW 13 13483790 missense probably benign 0.01
R1390:Nid1 UTSW 13 13476246 missense probably damaging 1.00
R1397:Nid1 UTSW 13 13508795 missense possibly damaging 0.94
R2057:Nid1 UTSW 13 13500473 missense probably benign 0.00
R2058:Nid1 UTSW 13 13500473 missense probably benign 0.00
R2059:Nid1 UTSW 13 13500473 missense probably benign 0.00
R2132:Nid1 UTSW 13 13509486 missense probably benign 0.04
R2140:Nid1 UTSW 13 13499668 missense probably damaging 1.00
R2195:Nid1 UTSW 13 13476203 missense probably damaging 1.00
R2237:Nid1 UTSW 13 13500485 missense probably benign
R2312:Nid1 UTSW 13 13500493 missense probably benign 0.15
R2987:Nid1 UTSW 13 13499673 missense probably benign 0.40
R3696:Nid1 UTSW 13 13486759 missense probably damaging 0.99
R3697:Nid1 UTSW 13 13486759 missense probably damaging 0.99
R3698:Nid1 UTSW 13 13486759 missense probably damaging 0.99
R3772:Nid1 UTSW 13 13476418 splice site probably benign
R4092:Nid1 UTSW 13 13486639 missense probably damaging 0.96
R4126:Nid1 UTSW 13 13476372 missense probably damaging 1.00
R4680:Nid1 UTSW 13 13472852 missense probably damaging 1.00
R4717:Nid1 UTSW 13 13506501 missense probably benign 0.00
R4783:Nid1 UTSW 13 13499741 missense probably damaging 0.97
R4812:Nid1 UTSW 13 13506468 nonsense probably null
R4834:Nid1 UTSW 13 13508823 missense probably damaging 1.00
R4915:Nid1 UTSW 13 13499586 missense possibly damaging 0.89
R4930:Nid1 UTSW 13 13510011 missense probably damaging 1.00
R5101:Nid1 UTSW 13 13483754 missense probably damaging 1.00
R5276:Nid1 UTSW 13 13468572 missense probably damaging 0.99
R5427:Nid1 UTSW 13 13483683 missense probably damaging 1.00
R5447:Nid1 UTSW 13 13437910 missense probably benign 0.00
R5507:Nid1 UTSW 13 13489037 nonsense probably null
R5663:Nid1 UTSW 13 13472834 missense probably damaging 1.00
R5868:Nid1 UTSW 13 13489157 critical splice donor site probably null
R6313:Nid1 UTSW 13 13463782 missense probably benign 0.01
R6761:Nid1 UTSW 13 13482035 missense probably benign 0.22
R7069:Nid1 UTSW 13 13508768 missense probably benign
R7208:Nid1 UTSW 13 13468385 missense probably benign 0.01
R7284:Nid1 UTSW 13 13489090 missense probably benign 0.01
R7434:Nid1 UTSW 13 13468464 missense probably benign
R7449:Nid1 UTSW 13 13482051 missense probably damaging 1.00
R7574:Nid1 UTSW 13 13468443 missense probably benign
R7762:Nid1 UTSW 13 13489045 missense probably damaging 1.00
R7887:Nid1 UTSW 13 13499733 missense possibly damaging 0.83
R8420:Nid1 UTSW 13 13437831 missense possibly damaging 0.81
R8506:Nid1 UTSW 13 13476174 missense probably damaging 0.99
R8756:Nid1 UTSW 13 13508801 missense probably benign 0.32
R8903:Nid1 UTSW 13 13463930 missense probably benign 0.00
X0028:Nid1 UTSW 13 13509534 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- CACAACGGGTCAATGGCAAG -3'
(R):5'- TCTCCTGGTCCTTATTTCTGAGGAAG -3'

Sequencing Primer
(F):5'- TGAAGGGAAGGATCTTCGTGG -3'
(R):5'- AAGAACTAGAGGGCCCCTGTC -3'
Posted On2015-05-14