Incidental Mutation 'R4128:Jarid2'
ID315490
Institutional Source Beutler Lab
Gene Symbol Jarid2
Ensembl Gene ENSMUSG00000038518
Gene Namejumonji, AT rich interactive domain 2
Synonymsjumonji, Jmj
MMRRC Submission 041635-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4128 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location44729474-44921643 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44902256 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 313 (S313P)
Ref Sequence ENSEMBL: ENSMUSP00000134675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044608] [ENSMUST00000173246] [ENSMUST00000173367] [ENSMUST00000173704] [ENSMUST00000173906]
Predicted Effect probably damaging
Transcript: ENSMUST00000044608
AA Change: S313P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037774
Gene: ENSMUSG00000038518
AA Change: S313P

DomainStartEndE-ValueType
low complexity region 86 99 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
low complexity region 265 285 N/A INTRINSIC
low complexity region 334 353 N/A INTRINSIC
JmjN 554 595 1.77e-20 SMART
ARID 616 707 4.96e-24 SMART
BRIGHT 620 712 1.7e-29 SMART
low complexity region 791 800 N/A INTRINSIC
JmjC 882 1046 1.04e-50 SMART
Pfam:zf-C5HC2 1137 1191 2.4e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173246
AA Change: S313P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134205
Gene: ENSMUSG00000038518
AA Change: S313P

DomainStartEndE-ValueType
low complexity region 86 99 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
low complexity region 265 285 N/A INTRINSIC
low complexity region 334 353 N/A INTRINSIC
JmjN 554 595 1.77e-20 SMART
ARID 616 707 4.96e-24 SMART
BRIGHT 620 712 1.7e-29 SMART
low complexity region 791 800 N/A INTRINSIC
JmjC 882 1046 1.04e-50 SMART
Pfam:zf-C5HC2 1137 1191 2.4e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173367
AA Change: S174P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134658
Gene: ENSMUSG00000038518
AA Change: S174P

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
low complexity region 126 146 N/A INTRINSIC
low complexity region 195 214 N/A INTRINSIC
JmjN 415 456 1.77e-20 SMART
PDB:2RQ5|A 476 507 3e-14 PDB
Blast:ARID 477 507 2e-14 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000173704
AA Change: S313P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134675
Gene: ENSMUSG00000038518
AA Change: S313P

DomainStartEndE-ValueType
low complexity region 86 99 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
low complexity region 265 285 N/A INTRINSIC
low complexity region 334 353 N/A INTRINSIC
JmjN 554 595 1.77e-20 SMART
ARID 616 707 4.96e-24 SMART
BRIGHT 620 712 1.7e-29 SMART
low complexity region 791 800 N/A INTRINSIC
JmjC 882 1046 1.04e-50 SMART
Pfam:zf-C5HC2 1137 1190 1e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173906
AA Change: S275P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134630
Gene: ENSMUSG00000038518
AA Change: S275P

DomainStartEndE-ValueType
low complexity region 48 61 N/A INTRINSIC
low complexity region 143 157 N/A INTRINSIC
low complexity region 227 247 N/A INTRINSIC
low complexity region 296 315 N/A INTRINSIC
JmjN 516 557 1.77e-20 SMART
ARID 578 669 4.96e-24 SMART
BRIGHT 582 674 1.7e-29 SMART
low complexity region 753 762 N/A INTRINSIC
JmjC 844 1008 1.04e-50 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174683
Meta Mutation Damage Score 0.0780 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Jumonji- and AT-rich interaction domain (ARID)-domain-containing protein. The encoded protein is a DNA-binding protein that functions as a transcriptional repressor. This protein interacts with the Polycomb repressive complex 2 (PRC2) which plays an essential role in regulating gene expression during embryonic development. This protein facilitates the recruitment of the PRC2 complex to target genes. Alternate splicing results in multiple transcript variants. Mutations in this gene are associated with chronic myeloid malignancies. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygous mutants show strain-specific phenotypes, including embryonic death and defective neural tube closure, impaired hematopoiesis and hypoplasia of liver, thymus and spleen. Homozygotes for another mutation die at birth with cardiac defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl4 C T 3: 95,681,672 R483Q probably benign Het
Bbox1 A G 2: 110,270,180 V224A probably benign Het
Cavin2 A G 1: 51,301,422 *419W probably null Het
Cdk19 A G 10: 40,394,395 I67V probably benign Het
Cds2 A G 2: 132,297,271 T145A probably benign Het
Chn2 G T 6: 54,272,978 R24M probably damaging Het
Csl T C 10: 99,758,600 D201G probably benign Het
Erap1 T C 13: 74,666,196 I33T probably damaging Het
Ermap T C 4: 119,187,111 T163A possibly damaging Het
Gnas A G 2: 174,300,165 N709S possibly damaging Het
Hsd17b14 G A 7: 45,563,008 V155M probably damaging Het
Igf2bp2 C T 16: 22,078,621 V281I probably benign Het
Ighj4 T C 12: 113,428,556 probably benign Het
Ireb2 T A 9: 54,881,432 D63E probably benign Het
Kcnj11 A G 7: 46,099,719 F60S probably damaging Het
Lyplal1 A G 1: 186,089,539 C129R possibly damaging Het
Mertk C T 2: 128,777,438 Q539* probably null Het
Myrip C A 9: 120,464,698 S753* probably null Het
Narf G A 11: 121,250,435 probably null Het
Neb C A 2: 52,292,700 L1051F probably damaging Het
Nid1 T C 13: 13,476,372 V498A probably damaging Het
Olfr509 T C 7: 108,646,426 N50S probably benign Het
Olfr761 A G 17: 37,952,790 I78T probably benign Het
Pam A G 1: 97,834,468 Y691H probably damaging Het
Poln A G 5: 34,103,951 S561P probably benign Het
Rab39 T A 9: 53,686,504 I154L probably benign Het
Rnf187 A T 11: 58,934,057 S220T probably benign Het
Stac C A 9: 111,604,058 probably null Het
Stxbp3 T C 3: 108,794,831 Q553R probably benign Het
Tmem179 A T 12: 112,511,027 F8I possibly damaging Het
Trip11 G A 12: 101,895,698 Q203* probably null Het
Ubash3a T C 17: 31,237,275 Y506H probably damaging Het
Unc13c C A 9: 73,734,537 A1225S probably damaging Het
Zranb1 C A 7: 132,966,552 S313* probably null Het
Other mutations in Jarid2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01572:Jarid2 APN 13 44884835 missense probably damaging 1.00
IGL02217:Jarid2 APN 13 44913201 missense probably damaging 1.00
IGL02378:Jarid2 APN 13 44914325 missense probably damaging 0.98
IGL02604:Jarid2 APN 13 44874401 missense probably damaging 1.00
IGL02865:Jarid2 APN 13 44910560 missense probably damaging 1.00
IGL02926:Jarid2 APN 13 44902929 missense probably benign 0.03
R0057:Jarid2 UTSW 13 44884856 missense probably damaging 0.96
R0426:Jarid2 UTSW 13 44840882 critical splice donor site probably null
R0545:Jarid2 UTSW 13 44902831 missense probably benign 0.10
R0562:Jarid2 UTSW 13 44902359 missense probably damaging 0.99
R1192:Jarid2 UTSW 13 44906545 missense probably damaging 1.00
R1241:Jarid2 UTSW 13 44884892 splice site probably benign
R1254:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1464:Jarid2 UTSW 13 44848381 missense probably damaging 0.97
R1464:Jarid2 UTSW 13 44848381 missense probably damaging 0.97
R1552:Jarid2 UTSW 13 44911199 missense probably damaging 1.00
R1728:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1729:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1730:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1739:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1783:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1785:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1844:Jarid2 UTSW 13 44902743 missense possibly damaging 0.71
R1896:Jarid2 UTSW 13 44884882 critical splice donor site probably null
R1965:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1966:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1995:Jarid2 UTSW 13 44874441 missense probably damaging 1.00
R2120:Jarid2 UTSW 13 44906336 missense probably benign 0.17
R2142:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R2172:Jarid2 UTSW 13 44902539 missense probably damaging 0.99
R2242:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R2245:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R3110:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R3111:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R3112:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R3115:Jarid2 UTSW 13 44896466 missense probably damaging 1.00
R3620:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R3704:Jarid2 UTSW 13 44902355 missense probably benign
R3802:Jarid2 UTSW 13 44902831 missense probably benign 0.10
R3804:Jarid2 UTSW 13 44902831 missense probably benign 0.10
R4126:Jarid2 UTSW 13 44902256 missense probably damaging 1.00
R4127:Jarid2 UTSW 13 44902256 missense probably damaging 1.00
R4153:Jarid2 UTSW 13 44910426 missense probably damaging 1.00
R4844:Jarid2 UTSW 13 44913772 missense probably damaging 0.96
R5044:Jarid2 UTSW 13 44906565 missense probably damaging 1.00
R5329:Jarid2 UTSW 13 44906271 missense possibly damaging 0.49
R5632:Jarid2 UTSW 13 44896290 missense probably damaging 0.97
R5820:Jarid2 UTSW 13 44902301 missense possibly damaging 0.96
R6267:Jarid2 UTSW 13 44903063 missense possibly damaging 0.93
R6296:Jarid2 UTSW 13 44903063 missense possibly damaging 0.93
R6479:Jarid2 UTSW 13 44848289 missense probably benign 0.22
R6619:Jarid2 UTSW 13 44874396 missense probably damaging 1.00
R6633:Jarid2 UTSW 13 44884877 missense probably damaging 0.97
R6970:Jarid2 UTSW 13 44902985 missense probably damaging 1.00
R7020:Jarid2 UTSW 13 44884824 missense probably damaging 1.00
R7155:Jarid2 UTSW 13 44902462 missense probably damaging 1.00
R7223:Jarid2 UTSW 13 44896322 missense possibly damaging 0.89
R7265:Jarid2 UTSW 13 44902272 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- TACACAGTGGGCTGCACAATG -3'
(R):5'- ATTGTGTGGTTGACAGCTGAAC -3'

Sequencing Primer
(F):5'- GGTATGAAACTCGTCATTCAGCTAGC -3'
(R):5'- CAGCTGAACTGGGTTTGTGG -3'
Posted On2015-05-14