Incidental Mutation 'R4130:C87977'
ID 315502
Institutional Source Beutler Lab
Gene Symbol C87977
Ensembl Gene ENSMUSG00000046262
Gene Name expressed sequence C87977
Synonyms
MMRRC Submission 041636-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock # R4130 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 144206775-144213318 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 144208809 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 121 (I121F)
Ref Sequence ENSEMBL: ENSMUSP00000101383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105753] [ENSMUST00000105754] [ENSMUST00000105755] [ENSMUST00000105757] [ENSMUST00000146836] [ENSMUST00000147855]
AlphaFold A2A958
Predicted Effect possibly damaging
Transcript: ENSMUST00000105753
AA Change: I121F

PolyPhen 2 Score 0.823 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000105754
AA Change: I121F

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000105755
SMART Domains Protein: ENSMUSP00000101381
Gene: ENSMUSG00000046262

DomainStartEndE-ValueType
SCOP:d1a4ya_ 52 250 9e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105757
AA Change: I121F

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101383
Gene: ENSMUSG00000046262
AA Change: I121F

DomainStartEndE-ValueType
SCOP:d1a4ya_ 222 420 1e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132946
Predicted Effect possibly damaging
Transcript: ENSMUST00000146836
AA Change: I49F

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000147855
AA Change: I123F

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (29/29)
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021A07Rik T C 10: 21,425,542 noncoding transcript Het
A4gnt A G 9: 99,620,618 D277G possibly damaging Het
Adam12 C T 7: 133,912,924 V345I probably damaging Het
Ankrd29 G A 18: 12,254,700 A275V possibly damaging Het
Arpp21 T A 9: 112,155,308 probably benign Het
Bbx T C 16: 50,224,858 K447E probably damaging Het
Bcar1 A G 8: 111,714,165 L399P possibly damaging Het
Cytl1 T C 5: 37,735,641 S32P probably damaging Het
Eif4e1b C T 13: 54,787,317 T219M probably benign Het
F10 A G 8: 13,055,584 D383G possibly damaging Het
Gm37267 T G 1: 180,509,078 noncoding transcript Het
Golga2 G A 2: 32,288,166 R29H probably benign Het
Gpd1 A T 15: 99,719,277 probably null Het
Lrrk2 G A 15: 91,755,794 R1514Q probably benign Het
Map1b T C 13: 99,431,680 E1511G unknown Het
Nup35 G A 2: 80,656,099 probably benign Het
Olfr702 C T 7: 106,823,585 G314S probably benign Het
Pdzd9 A T 7: 120,662,869 D123E possibly damaging Het
Rab3gap2 A G 1: 185,204,297 D19G possibly damaging Het
Rnf213 T C 11: 119,483,006 S4972P probably damaging Het
Skap1 A G 11: 96,526,045 Y52C probably damaging Het
Sphkap T C 1: 83,277,898 N710S probably damaging Het
Tedc1 T A 12: 113,163,208 D363E probably benign Het
Vmn2r44 T A 7: 8,367,919 Q709H probably damaging Het
Wdr5 G T 2: 27,520,429 probably benign Het
Other mutations in C87977
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:C87977 APN 4 144208475 missense possibly damaging 0.58
IGL02950:C87977 APN 4 144212961 missense probably benign 0.06
IGL03174:C87977 APN 4 144208430 missense probably benign
IGL03178:C87977 APN 4 144208251 critical splice donor site probably null
PIT4812001:C87977 UTSW 4 144209516 missense probably benign
R0622:C87977 UTSW 4 144213013 unclassified probably benign
R0634:C87977 UTSW 4 144209340 critical splice donor site probably null
R1127:C87977 UTSW 4 144207124 missense probably damaging 1.00
R1341:C87977 UTSW 4 144207559 missense probably damaging 1.00
R1697:C87977 UTSW 4 144208592 missense probably damaging 1.00
R1827:C87977 UTSW 4 144209610 missense probably damaging 0.99
R1857:C87977 UTSW 4 144208521 missense possibly damaging 0.74
R2859:C87977 UTSW 4 144209622 missense probably benign 0.11
R4063:C87977 UTSW 4 144208695 missense possibly damaging 0.87
R4114:C87977 UTSW 4 144209603 missense probably damaging 1.00
R4255:C87977 UTSW 4 144207484 missense possibly damaging 0.68
R4704:C87977 UTSW 4 144208592 missense probably damaging 1.00
R4840:C87977 UTSW 4 144208574 missense probably damaging 0.98
R5267:C87977 UTSW 4 144213005 unclassified probably benign
R5670:C87977 UTSW 4 144209622 missense probably benign 0.11
R6149:C87977 UTSW 4 144207413 missense probably damaging 0.98
R6508:C87977 UTSW 4 144207601 nonsense probably null
R6528:C87977 UTSW 4 144208811 missense probably damaging 0.99
R7252:C87977 UTSW 4 144212940 missense possibly damaging 0.95
R7564:C87977 UTSW 4 144212955 missense probably damaging 1.00
R7704:C87977 UTSW 4 144208521 missense possibly damaging 0.74
R8737:C87977 UTSW 4 144208622 missense probably damaging 1.00
Z1176:C87977 UTSW 4 144207461 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CCACTGCAGCAAGTATGTGGTAG -3'
(R):5'- GGCTAAAGATGCCCTCTTGC -3'

Sequencing Primer
(F):5'- GCAGCAAGTATGTGGTAGATTCATC -3'
(R):5'- GATGCCCTCTTGCAAAGAATG -3'
Posted On 2015-05-14