Incidental Mutation 'R4130:Bcar1'
ID315508
Institutional Source Beutler Lab
Gene Symbol Bcar1
Ensembl Gene ENSMUSG00000031955
Gene Namebreast cancer anti-estrogen resistance 1
Synonymsp130Cas, Cas, Crkas
MMRRC Submission 041636-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4130 (G1)
Quality Score204
Status Validated
Chromosome8
Chromosomal Location111710474-111743809 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111714165 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 399 (L399P)
Ref Sequence ENSEMBL: ENSMUSP00000148364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166232] [ENSMUST00000212349]
Predicted Effect possibly damaging
Transcript: ENSMUST00000166232
AA Change: L399P

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000129584
Gene: ENSMUSG00000031955
AA Change: L399P

DomainStartEndE-ValueType
SH3 6 64 3e-20 SMART
low complexity region 71 92 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 353 388 N/A INTRINSIC
low complexity region 430 448 N/A INTRINSIC
Pfam:Serine_rich 458 612 9e-49 PFAM
Pfam:DUF3513 658 868 2.1e-78 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000212349
AA Change: L399P

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.0878 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] BCAR1, or CAS, is an Src (MIM 190090) family kinase substrate involved in various cellular events, including migration, survival, transformation, and invasion (Sawada et al., 2006 [PubMed 17129785]).[supplied by OMIM, May 2009]
PHENOTYPE: Homozygous null embryos exhibit growth retardation and embryonic lethality, following disruption of cardiac myofibrils, increased vasodilation, and systemic congestion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021A07Rik T C 10: 21,425,542 noncoding transcript Het
A4gnt A G 9: 99,620,618 D277G possibly damaging Het
Adam12 C T 7: 133,912,924 V345I probably damaging Het
Ankrd29 G A 18: 12,254,700 A275V possibly damaging Het
Arpp21 T A 9: 112,155,308 probably benign Het
Bbx T C 16: 50,224,858 K447E probably damaging Het
C87977 T A 4: 144,208,809 I121F probably damaging Het
Cytl1 T C 5: 37,735,641 S32P probably damaging Het
Eif4e1b C T 13: 54,787,317 T219M probably benign Het
F10 A G 8: 13,055,584 D383G possibly damaging Het
Gm37267 T G 1: 180,509,078 noncoding transcript Het
Golga2 G A 2: 32,288,166 R29H probably benign Het
Gpd1 A T 15: 99,719,277 probably null Het
Lrrk2 G A 15: 91,755,794 R1514Q probably benign Het
Map1b T C 13: 99,431,680 E1511G unknown Het
Nup35 G A 2: 80,656,099 probably benign Het
Olfr702 C T 7: 106,823,585 G314S probably benign Het
Pdzd9 A T 7: 120,662,869 D123E possibly damaging Het
Rab3gap2 A G 1: 185,204,297 D19G possibly damaging Het
Rnf213 T C 11: 119,483,006 S4972P probably damaging Het
Skap1 A G 11: 96,526,045 Y52C probably damaging Het
Sphkap T C 1: 83,277,898 N710S probably damaging Het
Tedc1 T A 12: 113,163,208 D363E probably benign Het
Vmn2r44 T A 7: 8,367,919 Q709H probably damaging Het
Wdr5 G T 2: 27,520,429 probably benign Het
Other mutations in Bcar1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02220:Bcar1 APN 8 111711207 missense possibly damaging 0.82
IGL02852:Bcar1 APN 8 111715347 nonsense probably null
R1914:Bcar1 UTSW 8 111715398 missense probably damaging 0.98
R1915:Bcar1 UTSW 8 111715398 missense probably damaging 0.98
R4249:Bcar1 UTSW 8 111720893 missense probably benign
R4437:Bcar1 UTSW 8 111715389 missense probably damaging 1.00
R4794:Bcar1 UTSW 8 111720920 nonsense probably null
R4937:Bcar1 UTSW 8 111721037 missense probably damaging 0.98
R5402:Bcar1 UTSW 8 111714330 missense probably damaging 1.00
R5951:Bcar1 UTSW 8 111713400 missense probably benign 0.02
R6443:Bcar1 UTSW 8 111715338 missense probably damaging 1.00
R7595:Bcar1 UTSW 8 111720993 missense probably benign 0.01
R8313:Bcar1 UTSW 8 111713638 missense probably benign 0.01
R8373:Bcar1 UTSW 8 111715738 nonsense probably null
RF025:Bcar1 UTSW 8 111714177 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- AAGCTTGGCATGCAAGGTG -3'
(R):5'- AAGCCCAAGCCCTTTGATCC -3'

Sequencing Primer
(F):5'- GTGGCATTGCTCACAGCTC -3'
(R):5'- AAGCCCTTTGATCCCACCCG -3'
Posted On2015-05-14