Incidental Mutation 'R4130:Eif4e1b'
ID315514
Institutional Source Beutler Lab
Gene Symbol Eif4e1b
Ensembl Gene ENSMUSG00000074895
Gene Nameeukaryotic translation initiation factor 4E family member 1B
SynonymsEif4eloo
MMRRC Submission 041636-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4130 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location54783998-54788459 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 54787317 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 219 (T219M)
Ref Sequence ENSEMBL: ENSMUSP00000123294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026993] [ENSMUST00000099503] [ENSMUST00000110003] [ENSMUST00000126525] [ENSMUST00000126785] [ENSMUST00000131692] [ENSMUST00000132005] [ENSMUST00000132415] [ENSMUST00000132728] [ENSMUST00000139184] [ENSMUST00000141398] [ENSMUST00000142158] [ENSMUST00000152204] [ENSMUST00000163796] [ENSMUST00000163915]
Predicted Effect probably benign
Transcript: ENSMUST00000026993
SMART Domains Protein: ENSMUSP00000026993
Gene: ENSMUSG00000025875

DomainStartEndE-ValueType
Pfam:Tetraspannin 16 263 6.9e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099503
SMART Domains Protein: ENSMUSP00000097102
Gene: ENSMUSG00000025875

DomainStartEndE-ValueType
Pfam:Tetraspannin 16 266 1.3e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110003
AA Change: T219M

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000105630
Gene: ENSMUSG00000074895
AA Change: T219M

DomainStartEndE-ValueType
low complexity region 3 24 N/A INTRINSIC
Pfam:IF4E 66 227 2e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124055
Predicted Effect probably benign
Transcript: ENSMUST00000126525
SMART Domains Protein: ENSMUSP00000121625
Gene: ENSMUSG00000074895

DomainStartEndE-ValueType
Pfam:IF4E 63 111 3.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126785
AA Change: T225M

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000118697
Gene: ENSMUSG00000074895
AA Change: T225M

DomainStartEndE-ValueType
low complexity region 9 30 N/A INTRINSIC
Pfam:IF4E 72 234 1.7e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131692
SMART Domains Protein: ENSMUSP00000115287
Gene: ENSMUSG00000025875

DomainStartEndE-ValueType
Pfam:Tetraspannin 15 263 8.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132005
SMART Domains Protein: ENSMUSP00000116681
Gene: ENSMUSG00000074895

DomainStartEndE-ValueType
low complexity region 8 29 N/A INTRINSIC
Pfam:IF4E 71 175 3e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132415
SMART Domains Protein: ENSMUSP00000120733
Gene: ENSMUSG00000074895

DomainStartEndE-ValueType
Pfam:IF4E 63 162 1.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132728
AA Change: T219M

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000123294
Gene: ENSMUSG00000074895
AA Change: T219M

DomainStartEndE-ValueType
low complexity region 3 24 N/A INTRINSIC
Pfam:IF4E 66 228 4.9e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139184
SMART Domains Protein: ENSMUSP00000119305
Gene: ENSMUSG00000074895

DomainStartEndE-ValueType
low complexity region 3 24 N/A INTRINSIC
Pfam:IF4E 66 134 4.4e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141398
AA Change: T81M

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000114217
Gene: ENSMUSG00000074895
AA Change: T81M

DomainStartEndE-ValueType
Pfam:IF4E 1 90 6.6e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142158
AA Change: T224M

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000117092
Gene: ENSMUSG00000074895
AA Change: T224M

DomainStartEndE-ValueType
low complexity region 8 29 N/A INTRINSIC
Pfam:IF4E 71 233 4.8e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152204
SMART Domains Protein: ENSMUSP00000120619
Gene: ENSMUSG00000074895

DomainStartEndE-ValueType
low complexity region 3 24 N/A INTRINSIC
Pfam:IF4E 66 170 9.1e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163796
SMART Domains Protein: ENSMUSP00000131671
Gene: ENSMUSG00000025875

DomainStartEndE-ValueType
Pfam:Tetraspannin 13 193 4.3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163915
SMART Domains Protein: ENSMUSP00000130765
Gene: ENSMUSG00000025875

DomainStartEndE-ValueType
Pfam:Tetraspannin 13 143 5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171859
SMART Domains Protein: ENSMUSP00000128568
Gene: ENSMUSG00000025875

DomainStartEndE-ValueType
Pfam:Tetraspannin 1 79 3.6e-17 PFAM
Pfam:Tetraspannin 78 144 1.5e-13 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (29/29)
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021A07Rik T C 10: 21,425,542 noncoding transcript Het
A4gnt A G 9: 99,620,618 D277G possibly damaging Het
Adam12 C T 7: 133,912,924 V345I probably damaging Het
Ankrd29 G A 18: 12,254,700 A275V possibly damaging Het
Arpp21 T A 9: 112,155,308 probably benign Het
Bbx T C 16: 50,224,858 K447E probably damaging Het
Bcar1 A G 8: 111,714,165 L399P possibly damaging Het
C87977 T A 4: 144,208,809 I121F probably damaging Het
Cytl1 T C 5: 37,735,641 S32P probably damaging Het
F10 A G 8: 13,055,584 D383G possibly damaging Het
Gm37267 T G 1: 180,509,078 noncoding transcript Het
Golga2 G A 2: 32,288,166 R29H probably benign Het
Gpd1 A T 15: 99,719,277 probably null Het
Lrrk2 G A 15: 91,755,794 R1514Q probably benign Het
Map1b T C 13: 99,431,680 E1511G unknown Het
Nup35 G A 2: 80,656,099 probably benign Het
Olfr702 C T 7: 106,823,585 G314S probably benign Het
Pdzd9 A T 7: 120,662,869 D123E possibly damaging Het
Rab3gap2 A G 1: 185,204,297 D19G possibly damaging Het
Rnf213 T C 11: 119,483,006 S4972P probably damaging Het
Skap1 A G 11: 96,526,045 Y52C probably damaging Het
Sphkap T C 1: 83,277,898 N710S probably damaging Het
Tedc1 T A 12: 113,163,208 D363E probably benign Het
Vmn2r44 T A 7: 8,367,919 Q709H probably damaging Het
Wdr5 G T 2: 27,520,429 probably benign Het
Other mutations in Eif4e1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01614:Eif4e1b APN 13 54786916 missense probably damaging 1.00
R1766:Eif4e1b UTSW 13 54786891 missense probably damaging 0.98
R1858:Eif4e1b UTSW 13 54787278 unclassified probably null
R4426:Eif4e1b UTSW 13 54784483 missense probably benign 0.01
R4702:Eif4e1b UTSW 13 54787325 missense probably damaging 0.99
R5367:Eif4e1b UTSW 13 54786944 missense probably damaging 0.99
R5595:Eif4e1b UTSW 13 54786716 missense possibly damaging 0.49
R5976:Eif4e1b UTSW 13 54784822 missense probably damaging 1.00
R6195:Eif4e1b UTSW 13 54784205 missense probably null 0.13
R6574:Eif4e1b UTSW 13 54784898 missense probably damaging 1.00
R6610:Eif4e1b UTSW 13 54784315 intron probably benign
R6980:Eif4e1b UTSW 13 54784103 critical splice donor site probably null
R7131:Eif4e1b UTSW 13 54784100 missense probably null 0.97
R7349:Eif4e1b UTSW 13 54784193 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TCACTGAGGGATTCTATGACAGG -3'
(R):5'- TGCTTATACATGTTCCAAGAGAGG -3'

Sequencing Primer
(F):5'- GGTACTGGTCTATGAGTAAGACATG -3'
(R):5'- TAAAGAACCAGGCTGTCTGC -3'
Posted On2015-05-14