Incidental Mutation 'R4156:Ifi203'
ID315520
Institutional Source Beutler Lab
Gene Symbol Ifi203
Ensembl Gene ENSMUSG00000039997
Gene Nameinterferon activated gene 203
Synonyms
MMRRC Submission 040862-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R4156 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location173920407-173942672 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 173936540 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 122 (N122I)
Ref Sequence ENSEMBL: ENSMUSP00000122424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042228] [ENSMUST00000081216] [ENSMUST00000111210] [ENSMUST00000123708] [ENSMUST00000129829] [ENSMUST00000156895]
Predicted Effect probably benign
Transcript: ENSMUST00000042228
AA Change: N122I

PolyPhen 2 Score 0.257 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000042071
Gene: ENSMUSG00000039997
AA Change: N122I

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
Pfam:HIN 251 418 1.5e-77 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000081216
AA Change: N122I

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000079976
Gene: ENSMUSG00000039997
AA Change: N122I

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 174 183 N/A INTRINSIC
Pfam:HIN 203 370 1.3e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111210
SMART Domains Protein: ENSMUSP00000106841
Gene: ENSMUSG00000090272

DomainStartEndE-ValueType
PYRIN 5 83 3.71e-20 SMART
internal_repeat_1 152 166 2.38e-7 PROSPERO
low complexity region 170 200 N/A INTRINSIC
internal_repeat_1 208 222 2.38e-7 PROSPERO
low complexity region 225 249 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
Pfam:HIN 311 479 3.4e-76 PFAM
low complexity region 497 507 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000123708
AA Change: N122I

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000121480
Gene: ENSMUSG00000039997
AA Change: N122I

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 174 183 N/A INTRINSIC
Pfam:HIN 203 370 1.3e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128430
Predicted Effect probably damaging
Transcript: ENSMUST00000129829
AA Change: N122I

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122424
Gene: ENSMUSG00000039997
AA Change: N122I

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
low complexity region 607 623 N/A INTRINSIC
Pfam:HIN 665 831 7.2e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138143
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140143
Predicted Effect probably benign
Transcript: ENSMUST00000156895
AA Change: N122I

PolyPhen 2 Score 0.257 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000114221
Gene: ENSMUSG00000039997
AA Change: N122I

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
Pfam:HIN 251 418 1.5e-77 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 96% (44/46)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T A 3: 145,938,263 F69I possibly damaging Het
Acot12 C T 13: 91,784,763 L552F probably benign Het
Aff4 T A 11: 53,410,899 probably benign Het
Aldh18a1 A G 19: 40,551,281 V750A probably damaging Het
Anapc1 A G 2: 128,627,229 probably benign Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Bcl11b A T 12: 107,917,425 probably null Het
Ccpg1 C A 9: 73,012,167 Q355K probably benign Het
Cdc42bpb G A 12: 111,294,139 P1702S probably benign Het
Ddx20 G T 3: 105,678,933 Q699K probably benign Het
Ecd A G 14: 20,324,564 S503P probably damaging Het
Etaa1 C T 11: 17,940,281 R860Q probably damaging Het
Ffar2 T A 7: 30,819,668 Y149F probably damaging Het
Gamt T A 10: 80,260,724 R60* probably null Het
Gm1141 T C X: 71,939,555 C378R possibly damaging Het
Gm6871 T C 7: 41,546,086 N302S probably damaging Het
Hps3 A G 3: 20,029,229 S135P probably damaging Het
Leng9 T C 7: 4,149,434 D81G possibly damaging Het
Lrrc23 T A 6: 124,770,841 K262* probably null Het
Morc2b T A 17: 33,138,427 T124S probably benign Het
Mroh1 G A 15: 76,402,126 probably null Het
Naxe T C 3: 88,056,704 K240R probably benign Het
Ncan C A 8: 70,110,077 E510D possibly damaging Het
Ndufs4 A T 13: 114,307,854 S129R probably benign Het
Olfr1062 C A 2: 86,423,200 V159L possibly damaging Het
Olfr1098 T C 2: 86,922,878 Y218C probably damaging Het
Olfr186 A T 16: 59,027,568 F113Y probably damaging Het
Oog2 A G 4: 144,193,953 probably benign Het
Papola G A 12: 105,800,751 probably null Het
Plec A G 15: 76,172,253 S4517P probably damaging Het
Rpap1 C T 2: 119,774,179 R416H probably damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Rxfp2 G A 5: 150,051,555 V210I probably benign Het
Ryr3 T C 2: 112,653,675 D3909G probably damaging Het
Spata31d1a T A 13: 59,705,047 K76N possibly damaging Het
Srgn A G 10: 62,497,834 F55L possibly damaging Het
Tmem54 G A 4: 129,110,711 R151Q probably damaging Het
Tns1 T A 1: 73,914,631 N1848Y probably damaging Het
Trim33 G T 3: 103,310,314 V192L possibly damaging Het
Trpm5 G T 7: 143,089,055 L52I probably benign Het
Uaca A G 9: 60,871,753 S1141G probably benign Het
Vmn1r63 T C 7: 5,803,532 T34A possibly damaging Het
Vmn2r50 T C 7: 10,040,382 K529R probably benign Het
Vmn2r9 T C 5: 108,847,877 T302A possibly damaging Het
Ylpm1 T C 12: 85,057,403 probably benign Het
Zfp410 G A 12: 84,327,432 R181H probably damaging Het
Other mutations in Ifi203
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Ifi203 APN 1 173937740 critical splice donor site probably null
IGL02598:Ifi203 APN 1 173935002 splice site probably benign
IGL03172:Ifi203 APN 1 173936592 missense possibly damaging 0.94
IGL03334:Ifi203 APN 1 173937835 nonsense probably null
FR4304:Ifi203 UTSW 1 173928328 intron probably benign
R0593:Ifi203 UTSW 1 173928649 intron probably benign
R0827:Ifi203 UTSW 1 173928463 intron probably benign
R1163:Ifi203 UTSW 1 173924137 missense probably damaging 0.98
R1769:Ifi203 UTSW 1 173928760 nonsense probably null
R3415:Ifi203 UTSW 1 173928760 nonsense probably null
R3737:Ifi203 UTSW 1 173929474 intron probably benign
R3738:Ifi203 UTSW 1 173929474 intron probably benign
R3739:Ifi203 UTSW 1 173929474 intron probably benign
R3791:Ifi203 UTSW 1 173935080 missense possibly damaging 0.83
R3847:Ifi203 UTSW 1 173933796 missense possibly damaging 0.84
R4035:Ifi203 UTSW 1 173929474 intron probably benign
R4164:Ifi203 UTSW 1 173928463 intron probably benign
R4171:Ifi203 UTSW 1 173933775 splice site probably benign
R4200:Ifi203 UTSW 1 173924115 missense probably damaging 0.99
R4233:Ifi203 UTSW 1 173936533 missense possibly damaging 0.92
R4845:Ifi203 UTSW 1 173927029 missense probably benign 0.00
R4880:Ifi203 UTSW 1 173929150 intron probably benign
R5071:Ifi203 UTSW 1 173935110 missense possibly damaging 0.92
R5108:Ifi203 UTSW 1 173924014 missense probably damaging 1.00
R5284:Ifi203 UTSW 1 173928708 intron probably benign
R5335:Ifi203 UTSW 1 173926919 missense possibly damaging 0.71
R6198:Ifi203 UTSW 1 173924082 missense probably damaging 0.97
R6236:Ifi203 UTSW 1 173933913 missense probably benign 0.33
R6397:Ifi203 UTSW 1 173927204 missense probably benign 0.33
R6929:Ifi203 UTSW 1 173928774 intron probably benign
R7025:Ifi203 UTSW 1 173928385 intron probably benign
R7149:Ifi203 UTSW 1 173928928 missense unknown
R7320:Ifi203 UTSW 1 173929167 missense unknown
R7631:Ifi203 UTSW 1 173927122 missense unknown
R7913:Ifi203 UTSW 1 173926957 missense probably damaging 1.00
R8183:Ifi203 UTSW 1 173928700 missense unknown
R8297:Ifi203 UTSW 1 173937930 missense probably damaging 1.00
Z1088:Ifi203 UTSW 1 173928581 intron probably benign
Predicted Primers PCR Primer
(F):5'- GCTGTGTAATGATTTGATGTCTCCATC -3'
(R):5'- TAAGTAATTCTGAATGAGCTGCAGC -3'

Sequencing Primer
(F):5'- ATCACTGAGGCTTATACTGCAC -3'
(R):5'- GCTGCAGCTATCATCCCC -3'
Posted On2015-05-14