Incidental Mutation 'R4156:Olfr1098'
ID315522
Institutional Source Beutler Lab
Gene Symbol Olfr1098
Ensembl Gene ENSMUSG00000075169
Gene Nameolfactory receptor 1098
SynonymsMOR206-1, GA_x6K02T2Q125-48410458-48409511
MMRRC Submission 040862-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R4156 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86920949-86924545 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86922878 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 218 (Y218C)
Ref Sequence ENSEMBL: ENSMUSP00000107200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099872] [ENSMUST00000111574]
Predicted Effect probably damaging
Transcript: ENSMUST00000099872
AA Change: Y218C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097457
Gene: ENSMUSG00000075169
AA Change: Y218C

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 7e-29 PFAM
Pfam:7tm_4 140 283 3.3e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111574
AA Change: Y218C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107200
Gene: ENSMUSG00000075169
AA Change: Y218C

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.8e-52 PFAM
Pfam:7tm_1 41 309 8.1e-20 PFAM
Meta Mutation Damage Score 0.5340 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 96% (44/46)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T A 3: 145,938,263 F69I possibly damaging Het
Acot12 C T 13: 91,784,763 L552F probably benign Het
Aff4 T A 11: 53,410,899 probably benign Het
Aldh18a1 A G 19: 40,551,281 V750A probably damaging Het
Anapc1 A G 2: 128,627,229 probably benign Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Bcl11b A T 12: 107,917,425 probably null Het
Ccpg1 C A 9: 73,012,167 Q355K probably benign Het
Cdc42bpb G A 12: 111,294,139 P1702S probably benign Het
Ddx20 G T 3: 105,678,933 Q699K probably benign Het
Ecd A G 14: 20,324,564 S503P probably damaging Het
Etaa1 C T 11: 17,940,281 R860Q probably damaging Het
Ffar2 T A 7: 30,819,668 Y149F probably damaging Het
Gamt T A 10: 80,260,724 R60* probably null Het
Gm1141 T C X: 71,939,555 C378R possibly damaging Het
Gm6871 T C 7: 41,546,086 N302S probably damaging Het
Hps3 A G 3: 20,029,229 S135P probably damaging Het
Ifi203 T A 1: 173,936,540 N122I probably damaging Het
Leng9 T C 7: 4,149,434 D81G possibly damaging Het
Lrrc23 T A 6: 124,770,841 K262* probably null Het
Morc2b T A 17: 33,138,427 T124S probably benign Het
Mroh1 G A 15: 76,402,126 probably null Het
Naxe T C 3: 88,056,704 K240R probably benign Het
Ncan C A 8: 70,110,077 E510D possibly damaging Het
Ndufs4 A T 13: 114,307,854 S129R probably benign Het
Olfr1062 C A 2: 86,423,200 V159L possibly damaging Het
Olfr186 A T 16: 59,027,568 F113Y probably damaging Het
Oog2 A G 4: 144,193,953 probably benign Het
Papola G A 12: 105,800,751 probably null Het
Plec A G 15: 76,172,253 S4517P probably damaging Het
Rpap1 C T 2: 119,774,179 R416H probably damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Rxfp2 G A 5: 150,051,555 V210I probably benign Het
Ryr3 T C 2: 112,653,675 D3909G probably damaging Het
Spata31d1a T A 13: 59,705,047 K76N possibly damaging Het
Srgn A G 10: 62,497,834 F55L possibly damaging Het
Tmem54 G A 4: 129,110,711 R151Q probably damaging Het
Tns1 T A 1: 73,914,631 N1848Y probably damaging Het
Trim33 G T 3: 103,310,314 V192L possibly damaging Het
Trpm5 G T 7: 143,089,055 L52I probably benign Het
Uaca A G 9: 60,871,753 S1141G probably benign Het
Vmn1r63 T C 7: 5,803,532 T34A possibly damaging Het
Vmn2r50 T C 7: 10,040,382 K529R probably benign Het
Vmn2r9 T C 5: 108,847,877 T302A possibly damaging Het
Ylpm1 T C 12: 85,057,403 probably benign Het
Zfp410 G A 12: 84,327,432 R181H probably damaging Het
Other mutations in Olfr1098
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Olfr1098 APN 2 86922949 missense probably benign
IGL02547:Olfr1098 APN 2 86923028 missense probably damaging 1.00
IGL02881:Olfr1098 APN 2 86922713 missense possibly damaging 0.94
IGL03073:Olfr1098 APN 2 86923353 missense probably damaging 1.00
R0117:Olfr1098 UTSW 2 86922870 missense probably damaging 1.00
R0808:Olfr1098 UTSW 2 86923451 missense probably damaging 1.00
R1061:Olfr1098 UTSW 2 86922782 missense possibly damaging 0.93
R1471:Olfr1098 UTSW 2 86922578 splice site probably null
R1571:Olfr1098 UTSW 2 86923445 missense probably benign 0.01
R1680:Olfr1098 UTSW 2 86923161 missense probably benign 0.10
R2341:Olfr1098 UTSW 2 86922638 missense possibly damaging 0.63
R2368:Olfr1098 UTSW 2 86923107 missense probably benign
R3158:Olfr1098 UTSW 2 86922606 missense probably benign
R3425:Olfr1098 UTSW 2 86922606 missense probably benign
R3499:Olfr1098 UTSW 2 86923029 missense possibly damaging 0.94
R4526:Olfr1098 UTSW 2 86922995 missense possibly damaging 0.90
R5743:Olfr1098 UTSW 2 86923205 missense probably benign 0.01
R5942:Olfr1098 UTSW 2 86923406 missense probably damaging 1.00
R6372:Olfr1098 UTSW 2 86923155 missense probably damaging 1.00
R6409:Olfr1098 UTSW 2 86923171 nonsense probably null
R6517:Olfr1098 UTSW 2 86923097 missense probably benign 0.05
R6661:Olfr1098 UTSW 2 86923148 missense probably benign 0.02
R7075:Olfr1098 UTSW 2 86922646 missense possibly damaging 0.88
R7166:Olfr1098 UTSW 2 86922748 missense probably damaging 0.97
R8058:Olfr1098 UTSW 2 86922807 missense probably benign 0.32
R8234:Olfr1098 UTSW 2 86922969 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTTCAGCATGGGAATCAC -3'
(R):5'- GAGCTATAGATTCCTCTGCCAC -3'

Sequencing Primer
(F):5'- GGTTCAGCATGGGAATCACTATAG -3'
(R):5'- CACTGTCTTTTGGTTAAGCACACTGG -3'
Posted On2015-05-14