Incidental Mutation 'R4156:Ncan'
ID 315541
Institutional Source Beutler Lab
Gene Symbol Ncan
Ensembl Gene ENSMUSG00000002341
Gene Name neurocan
Synonyms Cspg3-rs, Tgfbit, Cspg3
MMRRC Submission 040862-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4156 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 70545735-70573494 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 70562727 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 510 (E510D)
Ref Sequence ENSEMBL: ENSMUSP00000002412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002412]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000002412
AA Change: E510D

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000002412
Gene: ENSMUSG00000002341
AA Change: E510D

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 23 30 N/A INTRINSIC
IG 43 157 9.63e-6 SMART
LINK 157 254 2.22e-56 SMART
LINK 258 356 4.72e-60 SMART
low complexity region 575 586 N/A INTRINSIC
low complexity region 602 632 N/A INTRINSIC
low complexity region 663 677 N/A INTRINSIC
EGF 963 996 6.5e-5 SMART
EGF_CA 998 1034 9.77e-9 SMART
CLECT 1040 1161 1.97e-41 SMART
CCP 1167 1223 2.53e-12 SMART
low complexity region 1225 1256 N/A INTRINSIC
Meta Mutation Damage Score 0.0610 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 96% (44/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurocan is a chondroitin sulfate proteoglycan thought to be involved in the modulation of cell adhesion and migration.[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for targeted null mutations are viable and fertile and exhibit normal behavior and brain anatomy; however, mild defects in long term potentiation were noted. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T A 3: 145,644,018 (GRCm39) F69I possibly damaging Het
Acot12 C T 13: 91,932,882 (GRCm39) L552F probably benign Het
Aff4 T A 11: 53,301,726 (GRCm39) probably benign Het
Aldh18a1 A G 19: 40,539,725 (GRCm39) V750A probably damaging Het
Anapc1 A G 2: 128,469,149 (GRCm39) probably benign Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 117,721,122 (GRCm39) probably benign Het
Bcl11b A T 12: 107,883,684 (GRCm39) probably null Het
Ccpg1 C A 9: 72,919,449 (GRCm39) Q355K probably benign Het
Cdc42bpb G A 12: 111,260,573 (GRCm39) P1702S probably benign Het
Ddx20 G T 3: 105,586,249 (GRCm39) Q699K probably benign Het
Ecd A G 14: 20,374,632 (GRCm39) S503P probably damaging Het
Etaa1 C T 11: 17,890,281 (GRCm39) R860Q probably damaging Het
Ffar2 T A 7: 30,519,093 (GRCm39) Y149F probably damaging Het
Gamt T A 10: 80,096,558 (GRCm39) R60* probably null Het
Gm6871 T C 7: 41,195,510 (GRCm39) N302S probably damaging Het
Hps3 A G 3: 20,083,393 (GRCm39) S135P probably damaging Het
Ifi203 T A 1: 173,764,106 (GRCm39) N122I probably damaging Het
Leng9 T C 7: 4,152,433 (GRCm39) D81G possibly damaging Het
Lrrc23 T A 6: 124,747,804 (GRCm39) K262* probably null Het
Morc2b T A 17: 33,357,401 (GRCm39) T124S probably benign Het
Mroh1 G A 15: 76,286,326 (GRCm39) probably null Het
Naxe T C 3: 87,964,011 (GRCm39) K240R probably benign Het
Ndufs4 A T 13: 114,444,390 (GRCm39) S129R probably benign Het
Oog2 A G 4: 143,920,523 (GRCm39) probably benign Het
Or5h18 A T 16: 58,847,931 (GRCm39) F113Y probably damaging Het
Or8h8 T C 2: 86,753,222 (GRCm39) Y218C probably damaging Het
Or8j3c C A 2: 86,253,544 (GRCm39) V159L possibly damaging Het
Papola G A 12: 105,767,010 (GRCm39) probably null Het
Pasd1 T C X: 70,983,161 (GRCm39) C378R possibly damaging Het
Plec A G 15: 76,056,453 (GRCm39) S4517P probably damaging Het
Rpap1 C T 2: 119,604,660 (GRCm39) R416H probably damaging Het
Rpl31-ps17 C T 12: 54,748,397 (GRCm39) noncoding transcript Het
Rxfp2 G A 5: 149,975,020 (GRCm39) V210I probably benign Het
Ryr3 T C 2: 112,484,020 (GRCm39) D3909G probably damaging Het
Spata31d1a T A 13: 59,852,861 (GRCm39) K76N possibly damaging Het
Srgn A G 10: 62,333,613 (GRCm39) F55L possibly damaging Het
Tmem54 G A 4: 129,004,504 (GRCm39) R151Q probably damaging Het
Tns1 T A 1: 73,953,790 (GRCm39) N1848Y probably damaging Het
Trim33 G T 3: 103,217,630 (GRCm39) V192L possibly damaging Het
Trpm5 G T 7: 142,642,792 (GRCm39) L52I probably benign Het
Uaca A G 9: 60,779,035 (GRCm39) S1141G probably benign Het
Vmn1r63 T C 7: 5,806,531 (GRCm39) T34A possibly damaging Het
Vmn2r50 T C 7: 9,774,309 (GRCm39) K529R probably benign Het
Vmn2r9 T C 5: 108,995,743 (GRCm39) T302A possibly damaging Het
Ylpm1 T C 12: 85,104,177 (GRCm39) probably benign Het
Zfp410 G A 12: 84,374,206 (GRCm39) R181H probably damaging Het
Other mutations in Ncan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Ncan APN 8 70,567,921 (GRCm39) missense probably benign 0.24
IGL00924:Ncan APN 8 70,561,039 (GRCm39) missense possibly damaging 0.78
IGL01319:Ncan APN 8 70,550,212 (GRCm39) missense probably damaging 0.99
IGL01407:Ncan APN 8 70,554,607 (GRCm39) missense probably benign 0.17
IGL01528:Ncan APN 8 70,562,731 (GRCm39) missense probably benign 0.00
IGL01567:Ncan APN 8 70,560,984 (GRCm39) missense probably benign 0.09
IGL01808:Ncan APN 8 70,560,090 (GRCm39) critical splice donor site probably null
IGL02543:Ncan APN 8 70,561,221 (GRCm39) missense probably benign 0.37
IGL02551:Ncan APN 8 70,555,112 (GRCm39) missense probably damaging 1.00
IGL02899:Ncan APN 8 70,567,698 (GRCm39) missense possibly damaging 0.95
IGL02940:Ncan APN 8 70,562,735 (GRCm39) missense probably benign 0.02
IGL03058:Ncan APN 8 70,560,582 (GRCm39) missense possibly damaging 0.83
learned UTSW 8 70,550,731 (GRCm39) nonsense probably null
sagacious UTSW 8 70,565,240 (GRCm39) missense probably damaging 0.99
R0219:Ncan UTSW 8 70,567,984 (GRCm39) missense probably benign 0.08
R0538:Ncan UTSW 8 70,561,252 (GRCm39) missense possibly damaging 0.86
R0540:Ncan UTSW 8 70,567,809 (GRCm39) missense possibly damaging 0.93
R0854:Ncan UTSW 8 70,565,202 (GRCm39) missense probably damaging 1.00
R0918:Ncan UTSW 8 70,561,039 (GRCm39) missense possibly damaging 0.78
R1344:Ncan UTSW 8 70,560,819 (GRCm39) missense probably benign
R1575:Ncan UTSW 8 70,562,848 (GRCm39) missense probably benign 0.27
R1739:Ncan UTSW 8 70,560,736 (GRCm39) missense probably benign 0.03
R1847:Ncan UTSW 8 70,555,104 (GRCm39) missense probably damaging 0.96
R1859:Ncan UTSW 8 70,567,998 (GRCm39) missense possibly damaging 0.94
R2320:Ncan UTSW 8 70,560,868 (GRCm39) missense probably benign
R2370:Ncan UTSW 8 70,565,463 (GRCm39) missense probably benign 0.05
R3407:Ncan UTSW 8 70,564,801 (GRCm39) missense probably damaging 1.00
R3408:Ncan UTSW 8 70,564,801 (GRCm39) missense probably damaging 1.00
R3961:Ncan UTSW 8 70,562,950 (GRCm39) missense probably benign 0.05
R4155:Ncan UTSW 8 70,562,727 (GRCm39) missense possibly damaging 0.87
R4365:Ncan UTSW 8 70,567,861 (GRCm39) missense probably damaging 1.00
R4858:Ncan UTSW 8 70,556,705 (GRCm39) missense probably benign 0.00
R4925:Ncan UTSW 8 70,562,604 (GRCm39) missense probably benign 0.02
R4942:Ncan UTSW 8 70,552,944 (GRCm39) missense probably damaging 1.00
R4976:Ncan UTSW 8 70,567,675 (GRCm39) missense probably damaging 0.98
R5119:Ncan UTSW 8 70,567,675 (GRCm39) missense probably damaging 0.98
R5141:Ncan UTSW 8 70,565,487 (GRCm39) missense probably damaging 1.00
R5679:Ncan UTSW 8 70,565,276 (GRCm39) missense probably damaging 1.00
R5706:Ncan UTSW 8 70,554,667 (GRCm39) missense probably damaging 0.99
R5915:Ncan UTSW 8 70,550,731 (GRCm39) nonsense probably null
R6033:Ncan UTSW 8 70,565,240 (GRCm39) missense probably damaging 0.99
R6033:Ncan UTSW 8 70,565,240 (GRCm39) missense probably damaging 0.99
R6223:Ncan UTSW 8 70,562,604 (GRCm39) missense probably benign 0.02
R6390:Ncan UTSW 8 70,567,899 (GRCm39) missense probably benign 0.34
R6533:Ncan UTSW 8 70,549,007 (GRCm39) missense probably benign 0.01
R6836:Ncan UTSW 8 70,552,965 (GRCm39) missense possibly damaging 0.84
R6869:Ncan UTSW 8 70,560,557 (GRCm39) missense probably benign 0.08
R7229:Ncan UTSW 8 70,552,961 (GRCm39) missense possibly damaging 0.69
R7232:Ncan UTSW 8 70,564,738 (GRCm39) missense probably damaging 1.00
R7293:Ncan UTSW 8 70,567,861 (GRCm39) missense probably damaging 0.98
R7406:Ncan UTSW 8 70,562,749 (GRCm39) missense probably benign 0.00
R7474:Ncan UTSW 8 70,554,691 (GRCm39) missense possibly damaging 0.53
R7779:Ncan UTSW 8 70,567,661 (GRCm39) missense probably damaging 0.99
R7973:Ncan UTSW 8 70,550,225 (GRCm39) missense probably benign 0.00
R8113:Ncan UTSW 8 70,561,221 (GRCm39) missense possibly damaging 0.58
R8269:Ncan UTSW 8 70,560,330 (GRCm39) missense probably benign 0.01
R8947:Ncan UTSW 8 70,555,171 (GRCm39) missense probably damaging 0.98
R9324:Ncan UTSW 8 70,560,648 (GRCm39) missense possibly damaging 0.75
R9717:Ncan UTSW 8 70,554,628 (GRCm39) missense probably damaging 1.00
R9803:Ncan UTSW 8 70,560,751 (GRCm39) missense probably benign 0.06
Z1177:Ncan UTSW 8 70,550,122 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGGTTGCAGTCACCCTTTC -3'
(R):5'- AGACCCTTGGTTCTACTCCAG -3'

Sequencing Primer
(F):5'- GCAGTCACCCTTTCTCCTCAGG -3'
(R):5'- TGGCCCTCTTCAGAAAAGTG -3'
Posted On 2015-05-14