Mutagenetix > Incidental Mutation

Incidental Mutation 'R4156:Ncan'

315541

Institutional Source

Beutler Lab

Gene Symbol

Ncan

Ensembl Gene

ENSMUSG00000002341

Gene Name

neurocan

Synonyms

Cspg3, Cspg3-rs, neurocan, Tgfbit

MMRRC Submission

040862-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4156 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

70093085-70120873 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 70110077 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 510 (E510D)

Ref Sequence

ENSEMBL: ENSMUSP00000002412 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002412]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000002412
AA Change: E510D

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000002412
Gene: ENSMUSG00000002341
AA Change: E510D

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	23	30	N/A	INTRINSIC
IG	43	157	9.63e-6	SMART
LINK	157	254	2.22e-56	SMART
LINK	258	356	4.72e-60	SMART
low complexity region	575	586	N/A	INTRINSIC
low complexity region	602	632	N/A	INTRINSIC
low complexity region	663	677	N/A	INTRINSIC
EGF	963	996	6.5e-5	SMART
EGF_CA	998	1034	9.77e-9	SMART
CLECT	1040	1161	1.97e-41	SMART
CCP	1167	1223	2.53e-12	SMART
low complexity region	1225	1256	N/A	INTRINSIC

Meta Mutation Damage Score

0.0610

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.6%

Validation Efficiency

96% (44/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurocan is a chondroitin sulfate proteoglycan thought to be involved in the modulation of cell adhesion and migration.[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for targeted null mutations are viable and fertile and exhibit normal behavior and brain anatomy; however, mild defects in long term potentiation were noted. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410004B18Rik	T	A	3: 145,938,263	F69I	possibly damaging	Het
Acot12	C	T	13: 91,784,763	L552F	probably benign	Het
Aff4	T	A	11: 53,410,899		probably benign	Het
Aldh18a1	A	G	19: 40,551,281	V750A	probably damaging	Het
Anapc1	A	G	2: 128,627,229		probably benign	Het
Arl6ip1	AAAATAAATAAATAAATAAATAAATA	AAAATAAATAAATAAATAAATAAATAAATA	7: 118,121,899		probably benign	Het
Bcl11b	A	T	12: 107,917,425		probably null	Het
Ccpg1	C	A	9: 73,012,167	Q355K	probably benign	Het
Cdc42bpb	G	A	12: 111,294,139	P1702S	probably benign	Het
Ddx20	G	T	3: 105,678,933	Q699K	probably benign	Het
Ecd	A	G	14: 20,324,564	S503P	probably damaging	Het
Etaa1	C	T	11: 17,940,281	R860Q	probably damaging	Het
Ffar2	T	A	7: 30,819,668	Y149F	probably damaging	Het
Gamt	T	A	10: 80,260,724	R60*	probably null	Het
Gm1141	T	C	X: 71,939,555	C378R	possibly damaging	Het
Gm6871	T	C	7: 41,546,086	N302S	probably damaging	Het
Hps3	A	G	3: 20,029,229	S135P	probably damaging	Het
Ifi203	T	A	1: 173,936,540	N122I	probably damaging	Het
Leng9	T	C	7: 4,149,434	D81G	possibly damaging	Het
Lrrc23	T	A	6: 124,770,841	K262*	probably null	Het
Morc2b	T	A	17: 33,138,427	T124S	probably benign	Het
Mroh1	G	A	15: 76,402,126		probably null	Het
Naxe	T	C	3: 88,056,704	K240R	probably benign	Het
Ndufs4	A	T	13: 114,307,854	S129R	probably benign	Het
Olfr1062	C	A	2: 86,423,200	V159L	possibly damaging	Het
Olfr1098	T	C	2: 86,922,878	Y218C	probably damaging	Het
Olfr186	A	T	16: 59,027,568	F113Y	probably damaging	Het
Oog2	A	G	4: 144,193,953		probably benign	Het
Papola	G	A	12: 105,800,751		probably null	Het
Plec	A	G	15: 76,172,253	S4517P	probably damaging	Het
Rpap1	C	T	2: 119,774,179	R416H	probably damaging	Het
Rpl31-ps17	C	T	12: 54,701,612		noncoding transcript	Het
Rxfp2	G	A	5: 150,051,555	V210I	probably benign	Het
Ryr3	T	C	2: 112,653,675	D3909G	probably damaging	Het
Spata31d1a	T	A	13: 59,705,047	K76N	possibly damaging	Het
Srgn	A	G	10: 62,497,834	F55L	possibly damaging	Het
Tmem54	G	A	4: 129,110,711	R151Q	probably damaging	Het
Tns1	T	A	1: 73,914,631	N1848Y	probably damaging	Het
Trim33	G	T	3: 103,310,314	V192L	possibly damaging	Het
Trpm5	G	T	7: 143,089,055	L52I	probably benign	Het
Uaca	A	G	9: 60,871,753	S1141G	probably benign	Het
Vmn1r63	T	C	7: 5,803,532	T34A	possibly damaging	Het
Vmn2r50	T	C	7: 10,040,382	K529R	probably benign	Het
Vmn2r9	T	C	5: 108,847,877	T302A	possibly damaging	Het
Ylpm1	T	C	12: 85,057,403		probably benign	Het
Zfp410	G	A	12: 84,327,432	R181H	probably damaging	Het

Other mutations in Ncan

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00539:Ncan	APN	8	70115271	missense	probably benign	0.24
IGL00924:Ncan	APN	8	70108389	missense	possibly damaging	0.78
IGL01319:Ncan	APN	8	70097562	missense	probably damaging	0.99
IGL01407:Ncan	APN	8	70101957	missense	probably benign	0.17
IGL01528:Ncan	APN	8	70110081	missense	probably benign	0.00
IGL01567:Ncan	APN	8	70108334	missense	probably benign	0.09
IGL01808:Ncan	APN	8	70107440	critical splice donor site	probably null
IGL02543:Ncan	APN	8	70108571	missense	probably benign	0.37
IGL02551:Ncan	APN	8	70102462	missense	probably damaging	1.00
IGL02899:Ncan	APN	8	70115048	missense	possibly damaging	0.95
IGL02940:Ncan	APN	8	70110085	missense	probably benign	0.02
IGL03058:Ncan	APN	8	70107932	missense	possibly damaging	0.83
learned	UTSW	8	70098081	nonsense	probably null
sagacious	UTSW	8	70112590	missense	probably damaging	0.99
R0219:Ncan	UTSW	8	70115334	missense	probably benign	0.08
R0538:Ncan	UTSW	8	70108602	missense	possibly damaging	0.86
R0540:Ncan	UTSW	8	70115159	missense	possibly damaging	0.93
R0854:Ncan	UTSW	8	70112552	missense	probably damaging	1.00
R0918:Ncan	UTSW	8	70108389	missense	possibly damaging	0.78
R1344:Ncan	UTSW	8	70108169	missense	probably benign
R1575:Ncan	UTSW	8	70110198	missense	probably benign	0.27
R1739:Ncan	UTSW	8	70108086	missense	probably benign	0.03
R1847:Ncan	UTSW	8	70102454	missense	probably damaging	0.96
R1859:Ncan	UTSW	8	70115348	missense	possibly damaging	0.94
R2320:Ncan	UTSW	8	70108218	missense	probably benign
R2370:Ncan	UTSW	8	70112813	missense	probably benign	0.05
R3407:Ncan	UTSW	8	70112151	missense	probably damaging	1.00
R3408:Ncan	UTSW	8	70112151	missense	probably damaging	1.00
R3961:Ncan	UTSW	8	70110300	missense	probably benign	0.05
R4155:Ncan	UTSW	8	70110077	missense	possibly damaging	0.87
R4365:Ncan	UTSW	8	70115211	missense	probably damaging	1.00
R4858:Ncan	UTSW	8	70104055	missense	probably benign	0.00
R4925:Ncan	UTSW	8	70109954	missense	probably benign	0.02
R4942:Ncan	UTSW	8	70100294	missense	probably damaging	1.00
R4976:Ncan	UTSW	8	70115025	missense	probably damaging	0.98
R5119:Ncan	UTSW	8	70115025	missense	probably damaging	0.98
R5141:Ncan	UTSW	8	70112837	missense	probably damaging	1.00
R5679:Ncan	UTSW	8	70112626	missense	probably damaging	1.00
R5706:Ncan	UTSW	8	70102017	missense	probably damaging	0.99
R5915:Ncan	UTSW	8	70098081	nonsense	probably null
R6033:Ncan	UTSW	8	70112590	missense	probably damaging	0.99
R6033:Ncan	UTSW	8	70112590	missense	probably damaging	0.99
R6223:Ncan	UTSW	8	70109954	missense	probably benign	0.02
R6390:Ncan	UTSW	8	70115249	missense	probably benign	0.34
R6533:Ncan	UTSW	8	70096357	missense	probably benign	0.01
R6836:Ncan	UTSW	8	70100315	missense	possibly damaging	0.84
R6869:Ncan	UTSW	8	70107907	missense	probably benign	0.08
R7229:Ncan	UTSW	8	70100311	missense	possibly damaging	0.69
R7232:Ncan	UTSW	8	70112088	missense	probably damaging	1.00
R7293:Ncan	UTSW	8	70115211	missense	probably damaging	0.98
R7406:Ncan	UTSW	8	70110099	missense	probably benign	0.00
R7474:Ncan	UTSW	8	70102041	missense	possibly damaging	0.53
R7779:Ncan	UTSW	8	70115011	missense	probably damaging	0.99
R7973:Ncan	UTSW	8	70097575	missense	probably benign	0.00
R8113:Ncan	UTSW	8	70108571	missense	possibly damaging	0.58
R8269:Ncan	UTSW	8	70107680	missense	probably benign	0.01
R8947:Ncan	UTSW	8	70102521	missense	probably damaging	0.98
R9324:Ncan	UTSW	8	70107998	missense	possibly damaging	0.75
R9717:Ncan	UTSW	8	70101978	missense	probably damaging	1.00
R9803:Ncan	UTSW	8	70108101	missense	probably benign	0.06
Z1177:Ncan	UTSW	8	70097472	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GTGGTTGCAGTCACCCTTTC -3'
(R):5'- AGACCCTTGGTTCTACTCCAG -3'

Sequencing Primer
(F):5'- GCAGTCACCCTTTCTCCTCAGG -3'
(R):5'- TGGCCCTCTTCAGAAAAGTG -3'

Posted On

2015-05-14