Incidental Mutation 'R4156:Gamt'
ID315545
Institutional Source Beutler Lab
Gene Symbol Gamt
Ensembl Gene ENSMUSG00000020150
Gene Nameguanidinoacetate methyltransferase
SynonymsSpintz1
MMRRC Submission 040862-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.424) question?
Stock #R4156 (G1)
Quality Score120
Status Validated
Chromosome10
Chromosomal Location80258151-80261012 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 80260724 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 60 (R60*)
Ref Sequence ENSEMBL: ENSMUSP00000101002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020359] [ENSMUST00000020361] [ENSMUST00000092305] [ENSMUST00000105361] [ENSMUST00000105362] [ENSMUST00000105363] [ENSMUST00000105364] [ENSMUST00000156935]
Predicted Effect probably null
Transcript: ENSMUST00000020359
AA Change: R60*
SMART Domains Protein: ENSMUSP00000020359
Gene: ENSMUSG00000020150
AA Change: R60*

DomainStartEndE-ValueType
PDB:1XCL|A 2 252 1e-151 PDB
SCOP:d1khha_ 44 252 3e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000020361
SMART Domains Protein: ENSMUSP00000020361
Gene: ENSMUSG00000020153

DomainStartEndE-ValueType
low complexity region 36 46 N/A INTRINSIC
low complexity region 49 60 N/A INTRINSIC
Pfam:Oxidored_q6 98 208 1.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092305
SMART Domains Protein: ENSMUSP00000089958
Gene: ENSMUSG00000069565

DomainStartEndE-ValueType
RRM 11 83 1.89e-24 SMART
RRM 114 186 6.25e-25 SMART
low complexity region 238 261 N/A INTRINSIC
low complexity region 270 332 N/A INTRINSIC
low complexity region 363 394 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105361
SMART Domains Protein: ENSMUSP00000101000
Gene: ENSMUSG00000069565

DomainStartEndE-ValueType
RRM 11 83 1.89e-24 SMART
RRM 113 185 6.25e-25 SMART
low complexity region 237 260 N/A INTRINSIC
low complexity region 269 331 N/A INTRINSIC
low complexity region 363 394 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105362
SMART Domains Protein: ENSMUSP00000101001
Gene: ENSMUSG00000069565

DomainStartEndE-ValueType
RRM 11 83 1.89e-24 SMART
RRM 113 185 6.25e-25 SMART
low complexity region 237 260 N/A INTRINSIC
low complexity region 269 331 N/A INTRINSIC
low complexity region 362 393 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105363
AA Change: R60*
SMART Domains Protein: ENSMUSP00000101002
Gene: ENSMUSG00000020150
AA Change: R60*

DomainStartEndE-ValueType
PDB:1XCL|A 2 236 1e-155 PDB
SCOP:d1khha_ 44 236 2e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105364
SMART Domains Protein: ENSMUSP00000101003
Gene: ENSMUSG00000020153

DomainStartEndE-ValueType
low complexity region 36 46 N/A INTRINSIC
low complexity region 49 60 N/A INTRINSIC
Pfam:Oxidored_q6 98 208 1.9e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150328
Predicted Effect probably benign
Transcript: ENSMUST00000156935
SMART Domains Protein: ENSMUSP00000117497
Gene: ENSMUSG00000069565

DomainStartEndE-ValueType
RRM 3 75 1.89e-24 SMART
RRM 105 171 6.71e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157063
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 96% (44/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a methyltransferase that converts guanidoacetate to creatine, using S-adenosylmethionine as the methyl donor. Defects in this gene have been implicated in neurologic syndromes and muscular hypotonia, probably due to creatine deficiency and accumulation of guanidinoacetate in the brain of affected individuals. Two transcript variants encoding different isoforms have been described for this gene. Pseudogenes of this gene are found on chromosomes 2 and 13. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous null mice display increased postnatal lethality; reduced body weight, muscle tension, and creatine concentrations; infertility with impaired spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T A 3: 145,938,263 F69I possibly damaging Het
Acot12 C T 13: 91,784,763 L552F probably benign Het
Aff4 T A 11: 53,410,899 probably benign Het
Aldh18a1 A G 19: 40,551,281 V750A probably damaging Het
Anapc1 A G 2: 128,627,229 probably benign Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Bcl11b A T 12: 107,917,425 probably null Het
Ccpg1 C A 9: 73,012,167 Q355K probably benign Het
Cdc42bpb G A 12: 111,294,139 P1702S probably benign Het
Ddx20 G T 3: 105,678,933 Q699K probably benign Het
Ecd A G 14: 20,324,564 S503P probably damaging Het
Etaa1 C T 11: 17,940,281 R860Q probably damaging Het
Ffar2 T A 7: 30,819,668 Y149F probably damaging Het
Gm1141 T C X: 71,939,555 C378R possibly damaging Het
Gm6871 T C 7: 41,546,086 N302S probably damaging Het
Hps3 A G 3: 20,029,229 S135P probably damaging Het
Ifi203 T A 1: 173,936,540 N122I probably damaging Het
Leng9 T C 7: 4,149,434 D81G possibly damaging Het
Lrrc23 T A 6: 124,770,841 K262* probably null Het
Morc2b T A 17: 33,138,427 T124S probably benign Het
Mroh1 G A 15: 76,402,126 probably null Het
Naxe T C 3: 88,056,704 K240R probably benign Het
Ncan C A 8: 70,110,077 E510D possibly damaging Het
Ndufs4 A T 13: 114,307,854 S129R probably benign Het
Olfr1062 C A 2: 86,423,200 V159L possibly damaging Het
Olfr1098 T C 2: 86,922,878 Y218C probably damaging Het
Olfr186 A T 16: 59,027,568 F113Y probably damaging Het
Oog2 A G 4: 144,193,953 probably benign Het
Papola G A 12: 105,800,751 probably null Het
Plec A G 15: 76,172,253 S4517P probably damaging Het
Rpap1 C T 2: 119,774,179 R416H probably damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Rxfp2 G A 5: 150,051,555 V210I probably benign Het
Ryr3 T C 2: 112,653,675 D3909G probably damaging Het
Spata31d1a T A 13: 59,705,047 K76N possibly damaging Het
Srgn A G 10: 62,497,834 F55L possibly damaging Het
Tmem54 G A 4: 129,110,711 R151Q probably damaging Het
Tns1 T A 1: 73,914,631 N1848Y probably damaging Het
Trim33 G T 3: 103,310,314 V192L possibly damaging Het
Trpm5 G T 7: 143,089,055 L52I probably benign Het
Uaca A G 9: 60,871,753 S1141G probably benign Het
Vmn1r63 T C 7: 5,803,532 T34A possibly damaging Het
Vmn2r50 T C 7: 10,040,382 K529R probably benign Het
Vmn2r9 T C 5: 108,847,877 T302A possibly damaging Het
Ylpm1 T C 12: 85,057,403 probably benign Het
Zfp410 G A 12: 84,327,432 R181H probably damaging Het
Other mutations in Gamt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02174:Gamt APN 10 80258396 missense possibly damaging 0.89
IGL03115:Gamt APN 10 80258438 missense probably damaging 1.00
mr_bigger UTSW 10 80260724 nonsense probably null
R0001:Gamt UTSW 10 80259061 unclassified probably benign
R1471:Gamt UTSW 10 80260858 missense probably benign 0.37
R5049:Gamt UTSW 10 80258954 missense probably benign
R5890:Gamt UTSW 10 80259907 missense possibly damaging 0.94
R7910:Gamt UTSW 10 80258409 missense possibly damaging 0.95
R7991:Gamt UTSW 10 80258409 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGTAGAAATCTTCCCTGGGAGAG -3'
(R):5'- GTTTGCACAGCCTCACCATG -3'

Sequencing Primer
(F):5'- AATCTTCCCTGGGAGAGGAAGTTC -3'
(R):5'- ATGAGCTCTTCTGCAGCTAG -3'
Posted On2015-05-14