Incidental Mutation 'R4156:Acot12'
ID315554
Institutional Source Beutler Lab
Gene Symbol Acot12
Ensembl Gene ENSMUSG00000021620
Gene Nameacyl-CoA thioesterase 12
SynonymsCach, 1300004O04Rik, 4930449F15Rik
MMRRC Submission 040862-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R4156 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location91741512-91786148 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 91784763 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 552 (L552F)
Ref Sequence ENSEMBL: ENSMUSP00000022120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022120]
Predicted Effect probably benign
Transcript: ENSMUST00000022120
AA Change: L552F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000022120
Gene: ENSMUSG00000021620
AA Change: L552F

DomainStartEndE-ValueType
Pfam:4HBT 25 97 4.2e-12 PFAM
Pfam:4HBT 198 275 2.5e-14 PFAM
low complexity region 317 328 N/A INTRINSIC
Pfam:START 350 515 1.5e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159214
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 96% (44/46)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T A 3: 145,938,263 F69I possibly damaging Het
Aff4 T A 11: 53,410,899 probably benign Het
Aldh18a1 A G 19: 40,551,281 V750A probably damaging Het
Anapc1 A G 2: 128,627,229 probably benign Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Bcl11b A T 12: 107,917,425 probably null Het
Ccpg1 C A 9: 73,012,167 Q355K probably benign Het
Cdc42bpb G A 12: 111,294,139 P1702S probably benign Het
Ddx20 G T 3: 105,678,933 Q699K probably benign Het
Ecd A G 14: 20,324,564 S503P probably damaging Het
Etaa1 C T 11: 17,940,281 R860Q probably damaging Het
Ffar2 T A 7: 30,819,668 Y149F probably damaging Het
Gamt T A 10: 80,260,724 R60* probably null Het
Gm1141 T C X: 71,939,555 C378R possibly damaging Het
Gm6871 T C 7: 41,546,086 N302S probably damaging Het
Hps3 A G 3: 20,029,229 S135P probably damaging Het
Ifi203 T A 1: 173,936,540 N122I probably damaging Het
Leng9 T C 7: 4,149,434 D81G possibly damaging Het
Lrrc23 T A 6: 124,770,841 K262* probably null Het
Morc2b T A 17: 33,138,427 T124S probably benign Het
Mroh1 G A 15: 76,402,126 probably null Het
Naxe T C 3: 88,056,704 K240R probably benign Het
Ncan C A 8: 70,110,077 E510D possibly damaging Het
Ndufs4 A T 13: 114,307,854 S129R probably benign Het
Olfr1062 C A 2: 86,423,200 V159L possibly damaging Het
Olfr1098 T C 2: 86,922,878 Y218C probably damaging Het
Olfr186 A T 16: 59,027,568 F113Y probably damaging Het
Oog2 A G 4: 144,193,953 probably benign Het
Papola G A 12: 105,800,751 probably null Het
Plec A G 15: 76,172,253 S4517P probably damaging Het
Rpap1 C T 2: 119,774,179 R416H probably damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Rxfp2 G A 5: 150,051,555 V210I probably benign Het
Ryr3 T C 2: 112,653,675 D3909G probably damaging Het
Spata31d1a T A 13: 59,705,047 K76N possibly damaging Het
Srgn A G 10: 62,497,834 F55L possibly damaging Het
Tmem54 G A 4: 129,110,711 R151Q probably damaging Het
Tns1 T A 1: 73,914,631 N1848Y probably damaging Het
Trim33 G T 3: 103,310,314 V192L possibly damaging Het
Trpm5 G T 7: 143,089,055 L52I probably benign Het
Uaca A G 9: 60,871,753 S1141G probably benign Het
Vmn1r63 T C 7: 5,803,532 T34A possibly damaging Het
Vmn2r50 T C 7: 10,040,382 K529R probably benign Het
Vmn2r9 T C 5: 108,847,877 T302A possibly damaging Het
Ylpm1 T C 12: 85,057,403 probably benign Het
Zfp410 G A 12: 84,327,432 R181H probably damaging Het
Other mutations in Acot12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Acot12 APN 13 91781211 nonsense probably null
IGL01114:Acot12 APN 13 91757592 splice site probably benign
IGL01376:Acot12 APN 13 91784671 missense probably damaging 0.98
IGL01474:Acot12 APN 13 91772783 missense possibly damaging 0.53
IGL02206:Acot12 APN 13 91759987 missense probably damaging 1.00
IGL02999:Acot12 APN 13 91759981 missense probably damaging 0.97
IGL03237:Acot12 APN 13 91781269 missense probably benign 0.26
R0071:Acot12 UTSW 13 91781174 splice site probably benign
R0092:Acot12 UTSW 13 91741565 missense probably damaging 1.00
R0141:Acot12 UTSW 13 91771828 missense probably benign 0.02
R0331:Acot12 UTSW 13 91760064 critical splice donor site probably null
R0525:Acot12 UTSW 13 91760067 splice site probably benign
R0544:Acot12 UTSW 13 91784656 missense probably benign 0.02
R1509:Acot12 UTSW 13 91771875 critical splice donor site probably null
R1616:Acot12 UTSW 13 91772767 missense probably benign 0.02
R1773:Acot12 UTSW 13 91757557 missense probably benign 0.27
R1897:Acot12 UTSW 13 91784397 missense probably benign
R2047:Acot12 UTSW 13 91783003 missense probably damaging 1.00
R2102:Acot12 UTSW 13 91759977 missense probably benign 0.00
R3730:Acot12 UTSW 13 91760026 missense possibly damaging 0.61
R3735:Acot12 UTSW 13 91784346 missense probably benign
R3736:Acot12 UTSW 13 91784346 missense probably benign
R3912:Acot12 UTSW 13 91770089 missense probably benign 0.01
R4418:Acot12 UTSW 13 91784405 missense possibly damaging 0.46
R4879:Acot12 UTSW 13 91762964 missense probably benign 0.17
R5456:Acot12 UTSW 13 91741640 missense probably damaging 1.00
R5498:Acot12 UTSW 13 91781233 missense probably damaging 1.00
R5601:Acot12 UTSW 13 91782910 missense probably benign 0.10
R5998:Acot12 UTSW 13 91757534 missense possibly damaging 0.49
R6781:Acot12 UTSW 13 91784412 splice site probably null
R7208:Acot12 UTSW 13 91781242 missense probably benign 0.06
R7330:Acot12 UTSW 13 91741532 start codon destroyed probably null 0.89
R7560:Acot12 UTSW 13 91784391 missense probably benign
R7561:Acot12 UTSW 13 91770124 missense probably damaging 0.96
R7869:Acot12 UTSW 13 91771725 missense probably benign 0.12
X0050:Acot12 UTSW 13 91771837 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGAAAGACCTCTTCATCTCCCC -3'
(R):5'- GGTTTGGCTCCAAATCACCAG -3'

Sequencing Primer
(F):5'- CATCACAGTCTTATAATGTGTGTCC -3'
(R):5'- GGTTTGGCTCCAAATCACCAGAATAC -3'
Posted On2015-05-14