Incidental Mutation 'R4156:Ndufs4'
ID 315555
Institutional Source Beutler Lab
Gene Symbol Ndufs4
Ensembl Gene ENSMUSG00000021764
Gene Name NADH dehydrogenase (ubiquinone) Fe-S protein 4
Synonyms C1-18k, 6720411N02Rik
MMRRC Submission 040862-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.617) question?
Stock # R4156 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 114287795-114388258 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 114307854 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 129 (S129R)
Ref Sequence ENSEMBL: ENSMUSP00000022286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022286] [ENSMUST00000225035] [ENSMUST00000232101]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000022286
AA Change: S129R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000022286
Gene: ENSMUSG00000021764
AA Change: S129R

DomainStartEndE-ValueType
Pfam:ETC_C1_NDUFA4 76 170 8.3e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000225035
Predicted Effect probably benign
Transcript: ENSMUST00000225707
Predicted Effect probably benign
Transcript: ENSMUST00000232101
Meta Mutation Damage Score 0.0579 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 96% (44/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an nuclear-encoded accessory subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (complex I, or NADH:ubiquinone oxidoreductase). Complex I removes electrons from NADH and passes them to the electron acceptor ubiquinone. Mutations in this gene can cause mitochondrial complex I deficiencies such as Leigh syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit growth retardation, lethargy, loss of motor skills, blindness and decreased mitochondrial CI complex activity beginning at 5 weeks of age followed by death at week 7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T A 3: 145,938,263 F69I possibly damaging Het
Acot12 C T 13: 91,784,763 L552F probably benign Het
Aff4 T A 11: 53,410,899 probably benign Het
Aldh18a1 A G 19: 40,551,281 V750A probably damaging Het
Anapc1 A G 2: 128,627,229 probably benign Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Bcl11b A T 12: 107,917,425 probably null Het
Ccpg1 C A 9: 73,012,167 Q355K probably benign Het
Cdc42bpb G A 12: 111,294,139 P1702S probably benign Het
Ddx20 G T 3: 105,678,933 Q699K probably benign Het
Ecd A G 14: 20,324,564 S503P probably damaging Het
Etaa1 C T 11: 17,940,281 R860Q probably damaging Het
Ffar2 T A 7: 30,819,668 Y149F probably damaging Het
Gamt T A 10: 80,260,724 R60* probably null Het
Gm1141 T C X: 71,939,555 C378R possibly damaging Het
Gm6871 T C 7: 41,546,086 N302S probably damaging Het
Hps3 A G 3: 20,029,229 S135P probably damaging Het
Ifi203 T A 1: 173,936,540 N122I probably damaging Het
Leng9 T C 7: 4,149,434 D81G possibly damaging Het
Lrrc23 T A 6: 124,770,841 K262* probably null Het
Morc2b T A 17: 33,138,427 T124S probably benign Het
Mroh1 G A 15: 76,402,126 probably null Het
Naxe T C 3: 88,056,704 K240R probably benign Het
Ncan C A 8: 70,110,077 E510D possibly damaging Het
Olfr1062 C A 2: 86,423,200 V159L possibly damaging Het
Olfr1098 T C 2: 86,922,878 Y218C probably damaging Het
Olfr186 A T 16: 59,027,568 F113Y probably damaging Het
Oog2 A G 4: 144,193,953 probably benign Het
Papola G A 12: 105,800,751 probably null Het
Plec A G 15: 76,172,253 S4517P probably damaging Het
Rpap1 C T 2: 119,774,179 R416H probably damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Rxfp2 G A 5: 150,051,555 V210I probably benign Het
Ryr3 T C 2: 112,653,675 D3909G probably damaging Het
Spata31d1a T A 13: 59,705,047 K76N possibly damaging Het
Srgn A G 10: 62,497,834 F55L possibly damaging Het
Tmem54 G A 4: 129,110,711 R151Q probably damaging Het
Tns1 T A 1: 73,914,631 N1848Y probably damaging Het
Trim33 G T 3: 103,310,314 V192L possibly damaging Het
Trpm5 G T 7: 143,089,055 L52I probably benign Het
Uaca A G 9: 60,871,753 S1141G probably benign Het
Vmn1r63 T C 7: 5,803,532 T34A possibly damaging Het
Vmn2r50 T C 7: 10,040,382 K529R probably benign Het
Vmn2r9 T C 5: 108,847,877 T302A possibly damaging Het
Ylpm1 T C 12: 85,057,403 probably benign Het
Zfp410 G A 12: 84,327,432 R181H probably damaging Het
Other mutations in Ndufs4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00568:Ndufs4 APN 13 114307870 missense probably null 0.35
IGL03081:Ndufs4 APN 13 114307837 missense possibly damaging 0.52
R2157:Ndufs4 UTSW 13 114316978 missense probably damaging 0.99
R4155:Ndufs4 UTSW 13 114307854 missense probably benign 0.00
R4157:Ndufs4 UTSW 13 114307854 missense probably benign 0.00
R8021:Ndufs4 UTSW 13 114307815 critical splice donor site probably null
R8515:Ndufs4 UTSW 13 114288803 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAACGGGATTGGTGTAGC -3'
(R):5'- CACTTTGGGACTCTTCTGGAG -3'

Sequencing Primer
(F):5'- TTCTGAGTTCAAGGACAGCC -3'
(R):5'- CTTCTGGAGTTTTGTAATTCAGAGC -3'
Posted On 2015-05-14