Mutagenetix > Incidental Mutations

Incidental Mutation 'R0390:Prex2'

31558

Institutional Source

Beutler Lab

Gene Symbol

Prex2

Ensembl Gene

ENSMUSG00000048960

Gene Name

phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2

Synonyms

C030045D06Rik, 6230420N16Rik, Depdc2

MMRRC Submission

038596-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.152) question?

Stock #

R0390 (G1)

Quality Score

183

Status

Validated

Chromosome

Chromosomal Location

10993465-11303681 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 11089706 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000027056 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027056]

AlphaFold

Q3LAC4

Predicted Effect

probably null
Transcript: ENSMUST00000027056

SMART Domains

Protein: ENSMUSP00000027056
Gene: ENSMUSG00000048960

Domain	Start	End	E-Value	Type
RhoGEF	19	205	8.61e-45	SMART
PH	238	355	2.43e-12	SMART
DEP	383	456	4.46e-26	SMART
DEP	484	557	6.57e-15	SMART
PDZ	593	666	9.62e-2	SMART
PDZ	677	744	6.37e-8	SMART
low complexity region	1112	1127	N/A	INTRINSIC
low complexity region	1498	1507	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.1%
10x: 95.9%
20x: 92.0%

Validation Efficiency

98% (110/112)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphatidylinositol 3,4,5-trisphosphate (PIP3)-dependent Rac exchanger (PREX) family, which are Dbl-type guanine-nucleotide exchange factors for Rac family small G proteins. Structural domains of this protein include the catalytic diffuse B-cell lymphoma homology and pleckstrin homology (DHPH) domain, two disheveled, EGL-10, and pleckstrin homology (DEP) domains, two PDZ domains, and a C-terminal inositol polyphosphate-4 phosphatase (IP4P) domain that is found in one of the isoforms. This protein facilitates the exchange of GDP for GTP on Rac1, allowing the GTP-bound Rac1 to activate downstream effectors. Studies also show that the pleckstrin homology domain of this protein interacts with the phosphatase and tensin homolog (PTEN) gene product to inhibit PTEN phosphatase activity, thus activating the phosphoinositide-3 kinase (PI3K) signaling pathway. Conversely, the PTEN gene product has also been shown to inhibit the GEF activity of this protein. This gene plays a role in insulin-signaling pathways, and either mutations or overexpression of this gene have been observed in some cancers. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for gene trapped alleles may exhibit abnormal Purkinje cell dendrite morphology, a mild motor coordination defect that progressively worsens with age, hypoactivity, impaired glucose tolerance and/or insulin resistance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 110 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A730017C20Rik	T	A	18: 59,075,688	V136E	probably damaging	Het
Adam18	C	T	8: 24,674,054	G38R	probably benign	Het
Ap2m1	T	C	16: 20,541,099	M183T	probably damaging	Het
Apob	A	T	12: 7,988,678	I364F	probably damaging	Het
Arl6	A	T	16: 59,622,421		probably benign	Het
Cand2	A	G	6: 115,774,653	M15V	possibly damaging	Het
Cbl	A	G	9: 44,201,005	F131S	probably damaging	Het
Ccdc151	T	A	9: 21,991,708	H442L	probably benign	Het
Ccdc74a	A	G	16: 17,650,476	S321G	probably benign	Het
Cdc14b	T	C	13: 64,210,192		probably benign	Het
Cep152	T	C	2: 125,576,869		probably benign	Het
Cep290	A	G	10: 100,508,758	E479G	probably benign	Het
Chrm2	T	G	6: 36,524,111	I301R	probably benign	Het
Clec2e	A	G	6: 129,093,468	W197R	probably damaging	Het
Cnot10	G	T	9: 114,629,150	S96*	probably null	Het
Col19a1	A	G	1: 24,289,655		probably benign	Het
Csmd2	T	C	4: 128,133,673		probably benign	Het
Cthrc1	A	T	15: 39,086,764	*172L	probably null	Het
Cul9	A	T	17: 46,528,589	I821N	probably benign	Het
Daam1	G	C	12: 71,975,304		probably benign	Het
Dhx58	A	T	11: 100,699,264	I398N	probably damaging	Het
Dip2b	T	A	15: 100,193,913	H844Q	probably damaging	Het
Dmac2	A	G	7: 25,621,029	D50G	probably damaging	Het
Dmxl1	C	A	18: 49,879,362	Q1529K	probably benign	Het
Dtna	C	T	18: 23,597,501	P315L	probably damaging	Het
Ep300	T	C	15: 81,640,116	S1382P	unknown	Het
Fat2	A	T	11: 55,310,777	N490K	probably damaging	Het
Flg2	T	A	3: 93,200,355		probably benign	Het
Gm13084	T	A	4: 143,811,699	D234V	probably benign	Het
Gpatch1	T	C	7: 35,281,381		probably benign	Het
Grin2a	C	A	16: 9,579,585	K879N	possibly damaging	Het
Hacd3	A	C	9: 65,001,022	I164S	possibly damaging	Het
Hinfp	A	C	9: 44,298,948	C197G	probably damaging	Het
Hsd17b12	T	C	2: 94,114,990		probably benign	Het
Hsd3b1	A	T	3: 98,853,039	L212Q	probably damaging	Het
Ifrd1	C	T	12: 40,214,094		probably null	Het
Igf2bp2	A	G	16: 22,081,801	F129L	possibly damaging	Het
Kirrel3	T	A	9: 35,020,163	I409N	probably damaging	Het
Klhdc10	T	C	6: 30,447,412	I204T	probably damaging	Het
Kpna6	A	T	4: 129,657,804	S65R	possibly damaging	Het
Lama3	A	T	18: 12,407,563	D308V	probably benign	Het
Larp4b	T	A	13: 9,158,107		probably null	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lyzl1	A	T	18: 4,169,175	T11S	probably benign	Het
Man1c1	A	G	4: 134,578,315	L366P	probably damaging	Het
Mef2a	A	G	7: 67,251,724	M100T	probably damaging	Het
Mettl13	G	A	1: 162,538,889	H474Y	possibly damaging	Het
Mmp3	A	G	9: 7,451,320	D352G	probably benign	Het
Mns1	T	C	9: 72,452,804	I412T	probably damaging	Het
Mon2	T	C	10: 123,007,021	D1501G	probably null	Het
Mylk	G	T	16: 34,875,620	G242W	probably damaging	Het
Nav1	T	C	1: 135,449,966	D1715G	possibly damaging	Het
Nckap1l	T	C	15: 103,453,883	S2P	probably damaging	Het
Nek3	A	T	8: 22,128,729		probably benign	Het
Nfrkb	A	G	9: 31,388,897		probably benign	Het
Nlrp4d	T	C	7: 10,388,778	D53G	probably benign	Het
Nol8	T	C	13: 49,662,152	S561P	probably damaging	Het
Nuf2	A	C	1: 169,525,297		probably benign	Het
Ofcc1	T	A	13: 40,015,313	D866V	possibly damaging	Het
Olfr195	A	G	16: 59,149,299	I150V	probably benign	Het
Optn	A	G	2: 5,046,195	L125P	probably benign	Het
Otoa	T	A	7: 121,131,341	F588Y	probably benign	Het
Pappa	T	A	4: 65,351,613		probably null	Het
Pde5a	T	G	3: 122,835,583	C635W	probably damaging	Het
Pdgfb	A	T	15: 80,003,419		probably null	Het
Pih1d2	T	A	9: 50,621,046	C135S	probably damaging	Het
Plcg1	G	T	2: 160,752,366	C361F	probably damaging	Het
Ppp4r4	T	C	12: 103,601,360		probably benign	Het
Prdm10	G	A	9: 31,349,268		probably null	Het
Prss56	T	G	1: 87,184,730		probably null	Het
Prtg	A	G	9: 72,844,958	K209E	probably benign	Het
Ptprc	G	A	1: 138,122,575	T36I	possibly damaging	Het
Rasgrp4	A	G	7: 29,145,860	Y302C	probably damaging	Het
Rb1cc1	T	A	1: 6,248,634	M759K	probably damaging	Het
Rbm15b	T	A	9: 106,885,998	M324L	probably benign	Het
Rcbtb2	T	C	14: 73,178,547	V500A	probably damaging	Het
Rgs6	A	G	12: 83,133,677	K434R	probably damaging	Het
Rims1	C	T	1: 22,596,526	A125T	possibly damaging	Het
Robo3	A	G	9: 37,422,177	V746A	probably benign	Het
Rtl1	C	T	12: 109,591,386	E1340K	unknown	Het
Sacs	G	A	14: 61,205,640	D1712N	possibly damaging	Het
Samd4b	G	A	7: 28,403,977	P19S	probably benign	Het
Samhd1	T	C	2: 157,114,231	Y347C	probably damaging	Het
Sema6d	T	A	2: 124,658,490	I393N	probably damaging	Het
Sigmar1	C	T	4: 41,741,243	A4T	probably benign	Het
Skint9	C	A	4: 112,389,179	L245F	probably benign	Het
Slc35f5	T	C	1: 125,585,095	L372P	probably damaging	Het
Smc1b	A	T	15: 85,066,277	I1182N	probably damaging	Het
Smyd3	A	G	1: 178,957,573		probably benign	Het
Sptlc1	T	C	13: 53,337,612	D417G	probably benign	Het
Sv2c	T	C	13: 96,088,708	N31S	probably benign	Het
Tjp1	T	C	7: 65,314,990	D811G	probably damaging	Het
Top2b	A	G	14: 16,418,442	T1221A	probably benign	Het
Tph2	T	C	10: 115,174,109	D182G	probably damaging	Het
Traf6	C	T	2: 101,688,588	Q141*	probably null	Het
Ttn	T	C	2: 76,756,931	D21574G	probably damaging	Het
Uba2	T	A	7: 34,151,021	N367I	probably benign	Het
Ube2b	T	C	11: 51,988,602		probably benign	Het
Ubr5	G	T	15: 38,030,672	L426I	probably benign	Het
Ugt2a2	T	A	5: 87,464,148	H301L	probably benign	Het
Upf2	T	A	2: 6,018,894		probably benign	Het
Utrn	T	C	10: 12,710,060	D991G	probably benign	Het
Vmn2r25	T	C	6: 123,823,181	D734G	probably damaging	Het
Vmn2r68	T	A	7: 85,233,249		probably benign	Het
Vmn2r68	C	G	7: 85,233,258		probably null	Het
Vwf	T	A	6: 125,626,361	Y891*	probably null	Het
Wwox	C	T	8: 114,706,278	T228I	probably benign	Het
Zer1	C	T	2: 30,108,213		probably benign	Het
Zfp180	C	T	7: 24,104,707	H184Y	possibly damaging	Het
Zfp68	A	T	5: 138,607,225	Y279N	probably benign	Het

Other mutations in Prex2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00497:Prex2	APN	1	11186652	missense	possibly damaging	0.51
IGL00948:Prex2	APN	1	11170614	missense	probably damaging	0.98
IGL01087:Prex2	APN	1	11068104	missense	probably benign	0.00
IGL01490:Prex2	APN	1	11184545	splice site	probably null
IGL01533:Prex2	APN	1	11186741	nonsense	probably null
IGL01661:Prex2	APN	1	11208614	missense	probably benign	0.01
IGL01668:Prex2	APN	1	11153645	missense	probably benign	0.00
IGL01674:Prex2	APN	1	11170741	missense	probably damaging	1.00
IGL01716:Prex2	APN	1	11266054	missense	probably benign	0.04
IGL01867:Prex2	APN	1	11098503	missense	probably benign	0.11
IGL01954:Prex2	APN	1	11140011	missense	possibly damaging	0.75
IGL01990:Prex2	APN	1	11123233	splice site	probably benign
IGL02022:Prex2	APN	1	11297739	missense	probably benign	0.04
IGL02130:Prex2	APN	1	11112799	missense	probably damaging	1.00
IGL02130:Prex2	APN	1	11160162	missense	probably damaging	1.00
IGL02221:Prex2	APN	1	11061345	missense	probably benign	0.00
IGL02369:Prex2	APN	1	11101169	critical splice donor site	probably null
IGL02440:Prex2	APN	1	11153657	missense	possibly damaging	0.94
IGL02477:Prex2	APN	1	11204154	missense	probably benign
IGL02492:Prex2	APN	1	11123845	missense	possibly damaging	0.93
IGL03051:Prex2	APN	1	11142665	missense	probably damaging	1.00
IGL03154:Prex2	APN	1	11153633	missense	possibly damaging	0.63
IGL03158:Prex2	APN	1	11266067	missense	possibly damaging	0.89
IGL03308:Prex2	APN	1	11185175	missense	possibly damaging	0.89
IGL03338:Prex2	APN	1	11140265	missense	probably benign	0.01
R0042:Prex2	UTSW	1	11080081	missense	probably damaging	1.00
R0052:Prex2	UTSW	1	11160156	missense	probably damaging	1.00
R0052:Prex2	UTSW	1	11160156	missense	probably damaging	1.00
R0138:Prex2	UTSW	1	11285043	splice site	probably benign
R0206:Prex2	UTSW	1	11285144	missense	probably damaging	1.00
R0206:Prex2	UTSW	1	11285144	missense	probably damaging	1.00
R0208:Prex2	UTSW	1	11285144	missense	probably damaging	1.00
R0325:Prex2	UTSW	1	11200057	splice site	probably null
R0326:Prex2	UTSW	1	11285065	missense	probably damaging	1.00
R0492:Prex2	UTSW	1	11186633	splice site	probably benign
R0512:Prex2	UTSW	1	11199933	missense	probably benign
R0515:Prex2	UTSW	1	11199874	missense	probably damaging	0.99
R0894:Prex2	UTSW	1	11181898	missense	probably benign
R1259:Prex2	UTSW	1	11289270	missense	probably damaging	1.00
R1332:Prex2	UTSW	1	11204091	missense	probably damaging	1.00
R1356:Prex2	UTSW	1	11080092	nonsense	probably null
R1451:Prex2	UTSW	1	11156259	missense	probably benign	0.01
R1488:Prex2	UTSW	1	11193528	missense	probably benign	0.05
R1512:Prex2	UTSW	1	11061330	missense	possibly damaging	0.64
R1641:Prex2	UTSW	1	11231772	missense	probably damaging	0.99
R1667:Prex2	UTSW	1	11186757	missense	probably benign
R1678:Prex2	UTSW	1	11285089	missense	possibly damaging	0.51
R1736:Prex2	UTSW	1	11089884	splice site	probably benign
R1781:Prex2	UTSW	1	11199955	missense	probably benign	0.17
R1804:Prex2	UTSW	1	11132342	missense	probably damaging	1.00
R1836:Prex2	UTSW	1	11136780	missense	probably damaging	1.00
R1899:Prex2	UTSW	1	11162366	nonsense	probably null
R1900:Prex2	UTSW	1	11162366	nonsense	probably null
R2020:Prex2	UTSW	1	11162312	missense	probably damaging	0.98
R2114:Prex2	UTSW	1	11186713	missense	probably damaging	1.00
R2117:Prex2	UTSW	1	11186713	missense	probably damaging	1.00
R2436:Prex2	UTSW	1	11266152	missense	possibly damaging	0.90
R2902:Prex2	UTSW	1	11208614	missense	possibly damaging	0.77
R2915:Prex2	UTSW	1	11169853	missense	probably damaging	1.00
R2924:Prex2	UTSW	1	11098487	missense	probably damaging	1.00
R2981:Prex2	UTSW	1	11181962	missense	probably damaging	1.00
R3430:Prex2	UTSW	1	11149854	missense	possibly damaging	0.88
R3832:Prex2	UTSW	1	11156364	splice site	probably benign
R3870:Prex2	UTSW	1	11160192	missense	possibly damaging	0.86
R3963:Prex2	UTSW	1	11110357	missense	possibly damaging	0.93
R4012:Prex2	UTSW	1	11184516	missense	probably benign
R4030:Prex2	UTSW	1	11208568	missense	probably benign	0.06
R4214:Prex2	UTSW	1	11101159	missense	probably damaging	1.00
R4214:Prex2	UTSW	1	11285061	missense	probably damaging	1.00
R4242:Prex2	UTSW	1	11156304	missense	probably benign	0.06
R4490:Prex2	UTSW	1	11162263	missense	probably benign	0.05
R4491:Prex2	UTSW	1	11162263	missense	probably benign	0.05
R4492:Prex2	UTSW	1	11162263	missense	probably benign	0.05
R4561:Prex2	UTSW	1	11184545	splice site	probably null
R4624:Prex2	UTSW	1	11289265	nonsense	probably null
R4647:Prex2	UTSW	1	11162285	missense	probably damaging	1.00
R4657:Prex2	UTSW	1	11065825	missense	probably benign	0.00
R4706:Prex2	UTSW	1	11199988	missense	probably damaging	1.00
R4806:Prex2	UTSW	1	11068020	missense	probably damaging	1.00
R4900:Prex2	UTSW	1	11149905	splice site	probably benign
R4922:Prex2	UTSW	1	11169940	missense	probably damaging	1.00
R4961:Prex2	UTSW	1	11098481	missense	possibly damaging	0.75
R5284:Prex2	UTSW	1	11266090	nonsense	probably null
R5305:Prex2	UTSW	1	11107678	missense	probably damaging	1.00
R5307:Prex2	UTSW	1	11200032	missense	probably damaging	0.99
R5331:Prex2	UTSW	1	11140011	missense	possibly damaging	0.75
R5385:Prex2	UTSW	1	11139980	missense	probably damaging	0.99
R5574:Prex2	UTSW	1	11140058	missense	probably damaging	1.00
R5979:Prex2	UTSW	1	11132372	missense	probably damaging	1.00
R6076:Prex2	UTSW	1	11185950	missense	probably benign	0.09
R6160:Prex2	UTSW	1	10993851	missense	probably damaging	1.00
R6177:Prex2	UTSW	1	11136777	missense	possibly damaging	0.49
R6221:Prex2	UTSW	1	11266012	missense	probably benign	0.01
R6293:Prex2	UTSW	1	11162298	missense	probably benign
R6335:Prex2	UTSW	1	11110320	missense	probably benign	0.13
R6401:Prex2	UTSW	1	11186727	missense	probably benign	0.00
R6427:Prex2	UTSW	1	11182031	missense	probably damaging	1.00
R6467:Prex2	UTSW	1	11266035	missense	probably damaging	1.00
R6564:Prex2	UTSW	1	11101061	splice site	probably null
R6734:Prex2	UTSW	1	11080059	missense	probably damaging	1.00
R6753:Prex2	UTSW	1	11184456	missense	probably damaging	0.98
R6880:Prex2	UTSW	1	11132384	missense	probably damaging	1.00
R6973:Prex2	UTSW	1	11112743	missense	probably damaging	1.00
R6980:Prex2	UTSW	1	11162263	missense	probably benign	0.05
R6987:Prex2	UTSW	1	11170752	missense	probably damaging	0.99
R7085:Prex2	UTSW	1	11098588	missense	possibly damaging	0.73
R7101:Prex2	UTSW	1	11153609	missense	possibly damaging	0.86
R7106:Prex2	UTSW	1	11136793	missense	probably benign	0.33
R7319:Prex2	UTSW	1	11162308	missense	probably benign	0.10
R7342:Prex2	UTSW	1	11162325	missense	probably benign	0.00
R7469:Prex2	UTSW	1	11285069	missense	probably damaging	1.00
R7528:Prex2	UTSW	1	11204092	missense	probably damaging	1.00
R7592:Prex2	UTSW	1	11123213	missense	probably damaging	1.00
R7650:Prex2	UTSW	1	11149854	missense	possibly damaging	0.67
R7695:Prex2	UTSW	1	11162273	missense	probably benign	0.00
R7720:Prex2	UTSW	1	11181937	missense	possibly damaging	0.47
R7733:Prex2	UTSW	1	11181959	missense	probably benign	0.31
R7859:Prex2	UTSW	1	11080050	missense	probably damaging	1.00
R8247:Prex2	UTSW	1	11199970	missense	probably benign
R8300:Prex2	UTSW	1	11231718	missense	possibly damaging	0.49
R8345:Prex2	UTSW	1	11199894	missense	possibly damaging	0.65
R8352:Prex2	UTSW	1	11285139	missense	probably benign
R8352:Prex2	UTSW	1	11285140	missense	probably benign
R8410:Prex2	UTSW	1	11153657	missense	possibly damaging	0.94
R8452:Prex2	UTSW	1	11285139	missense	probably benign
R8452:Prex2	UTSW	1	11285140	missense	probably benign
R8885:Prex2	UTSW	1	11170575	splice site	probably benign
R8926:Prex2	UTSW	1	11089706	splice site	probably null
R8968:Prex2	UTSW	1	11110338	nonsense	probably null
R9049:Prex2	UTSW	1	11185906	missense	probably damaging	0.98
R9398:Prex2	UTSW	1	11136804	missense	probably benign	0.00
RF005:Prex2	UTSW	1	11185166	missense	possibly damaging	0.47
Z1177:Prex2	UTSW	1	11289252	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- AGTGTGTGAAATGAGGACATCAGCC -3'
(R):5'- TGTGTGCCTGCCACTCTTCTAAAAC -3'

Sequencing Primer
(F):5'- AGGACATCAGCCTATAGCTTCTC -3'
(R):5'- GCCACTCTTCTAAAACTTCCAG -3'

Posted On

2013-04-24