Incidental Mutation 'R4157:Krt9'
ID315592
Institutional Source Beutler Lab
Gene Symbol Krt9
Ensembl Gene ENSMUSG00000051617
Gene Namekeratin 9
SynonymsKrt1-9, K9
MMRRC Submission 041000-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4157 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location100186781-100193246 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100188649 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 639 (Y639F)
Ref Sequence ENSEMBL: ENSMUSP00000055255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059707]
Predicted Effect unknown
Transcript: ENSMUST00000059707
AA Change: Y639F
SMART Domains Protein: ENSMUSP00000055255
Gene: ENSMUSG00000051617
AA Change: Y639F

DomainStartEndE-ValueType
low complexity region 6 125 N/A INTRINSIC
Filament 130 442 2.96e-124 SMART
low complexity region 462 716 N/A INTRINSIC
low complexity region 721 737 N/A INTRINSIC
Meta Mutation Damage Score 0.0936 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 95% (52/55)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit hyperpigmented calluses on the footpad with acanthosis, hyperkeratosis, thick epidermis and increased keratinocyte proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik C G 6: 96,165,283 W260S possibly damaging Het
Adamts7 G T 9: 90,188,361 R585L probably damaging Het
Adamtsl5 C T 10: 80,345,322 R75Q probably null Het
Ankrd26 T A 6: 118,507,821 Q1485L probably damaging Het
Apbb2 G A 5: 66,302,604 R717* probably null Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Atp8b5 A G 4: 43,365,591 E735G probably damaging Het
Bcl11b A T 12: 107,917,425 probably null Het
C4b A G 17: 34,742,855 I139T probably damaging Het
Ccpg1 C A 9: 73,012,167 Q355K probably benign Het
Cdk8 A T 5: 146,299,449 probably benign Het
Ctif T C 18: 75,435,270 H599R probably benign Het
Degs1 A G 1: 182,282,627 I26T possibly damaging Het
Dnajc4 T C 19: 6,989,840 N72S probably damaging Het
Ecd A G 14: 20,324,564 S503P probably damaging Het
Gm1141 T C X: 71,939,555 C378R possibly damaging Het
Gm3486 G A 14: 41,486,386 L123F probably benign Het
Inpp5f C T 7: 128,679,699 probably benign Het
Irx4 A T 13: 73,265,543 Q44L probably benign Het
Lgals9 C A 11: 78,973,107 V71L possibly damaging Het
Mdga1 T C 17: 29,833,343 N143S probably benign Het
Ndufs4 A T 13: 114,307,854 S129R probably benign Het
Oog2 A G 4: 144,193,953 probably benign Het
Orm2 T A 4: 63,363,985 F133L probably null Het
Pidd1 A G 7: 141,441,366 V333A possibly damaging Het
Ppp4r3a A G 12: 101,055,619 F341L probably damaging Het
Rab11fip1 A T 8: 27,152,147 S875T probably damaging Het
Rpap1 C T 2: 119,774,179 R416H probably damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Snx22 T C 9: 66,068,211 Y92C probably damaging Het
Srgn A G 10: 62,497,834 F55L possibly damaging Het
Swt1 A T 1: 151,403,044 V454E probably damaging Het
Tmem54 G A 4: 129,110,711 R151Q probably damaging Het
Tns1 T A 1: 73,914,631 N1848Y probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Top2b A G 14: 16,384,491 N80S probably benign Het
Trim7 T C 11: 48,848,093 V313A probably benign Het
Uaca A G 9: 60,871,753 S1141G probably benign Het
Ubr3 T C 2: 69,959,669 probably null Het
Utp20 A G 10: 88,761,867 V121A probably benign Het
Wdr20 G A 12: 110,738,174 R49H possibly damaging Het
Ylpm1 T C 12: 85,057,403 probably benign Het
Zfp398 A T 6: 47,835,909 T5S probably benign Het
Zfp410 G A 12: 84,327,432 R181H probably damaging Het
Zfp523 C T 17: 28,202,283 A367V probably benign Het
Zfp748 G A 13: 67,542,106 S345L possibly damaging Het
Other mutations in Krt9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00725:Krt9 APN 11 100190006 missense probably damaging 1.00
IGL01695:Krt9 APN 11 100191437 critical splice donor site probably null
IGL02383:Krt9 APN 11 100191215 missense probably damaging 1.00
IGL02529:Krt9 APN 11 100189966 missense probably damaging 0.99
IGL02819:Krt9 APN 11 100191520 missense probably damaging 1.00
R1356:Krt9 UTSW 11 100188814 small insertion probably benign
R1397:Krt9 UTSW 11 100192638 missense probably damaging 1.00
R1498:Krt9 UTSW 11 100188369 nonsense probably null
R1772:Krt9 UTSW 11 100191305 missense probably damaging 0.99
R1871:Krt9 UTSW 11 100190788 missense probably damaging 1.00
R1883:Krt9 UTSW 11 100188697 missense unknown
R1985:Krt9 UTSW 11 100189991 missense probably benign 0.02
R2056:Krt9 UTSW 11 100191495 missense probably damaging 1.00
R2253:Krt9 UTSW 11 100190859 missense possibly damaging 0.83
R2305:Krt9 UTSW 11 100193116 missense unknown
R2875:Krt9 UTSW 11 100189205 nonsense probably null
R3813:Krt9 UTSW 11 100189677 missense probably damaging 1.00
R3874:Krt9 UTSW 11 100190849 missense probably damaging 1.00
R4762:Krt9 UTSW 11 100190849 missense probably damaging 1.00
R4873:Krt9 UTSW 11 100190037 missense probably benign 0.06
R4875:Krt9 UTSW 11 100190037 missense probably benign 0.06
R4923:Krt9 UTSW 11 100189077 small deletion probably benign
R4973:Krt9 UTSW 11 100188712 missense unknown
R5153:Krt9 UTSW 11 100191242 missense probably damaging 0.99
R5658:Krt9 UTSW 11 100190767 missense probably damaging 0.98
R5696:Krt9 UTSW 11 100189077 small deletion probably benign
R5944:Krt9 UTSW 11 100188439 missense unknown
R6147:Krt9 UTSW 11 100188839 missense unknown
R6403:Krt9 UTSW 11 100189659 missense probably damaging 0.99
R6476:Krt9 UTSW 11 100190814 missense probably damaging 1.00
R6822:Krt9 UTSW 11 100189077 small deletion probably benign
R7159:Krt9 UTSW 11 100189077 small deletion probably benign
R7174:Krt9 UTSW 11 100189077 small deletion probably benign
R7203:Krt9 UTSW 11 100190791 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACCACTTCCTCCTCCATAGC -3'
(R):5'- TGGAGGAGGAAGCAGCTCT -3'

Sequencing Primer
(F):5'- CCTCCATAGCTGCCTCCAC -3'
(R):5'- CAGCTCTGGGGGAGGAAGTG -3'
Posted On2015-05-14