Incidental Mutation 'R4157:Wdr20'
ID315598
Institutional Source Beutler Lab
Gene Symbol Wdr20
Ensembl Gene ENSMUSG00000037957
Gene NameWD repeat domain 20
SynonymsWdr20a, 2310040A13Rik
MMRRC Submission 041000-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.896) question?
Stock #R4157 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location110737944-110804238 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 110738174 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 49 (R49H)
Ref Sequence ENSEMBL: ENSMUSP00000141887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095410] [ENSMUST00000192870] [ENSMUST00000193053] [ENSMUST00000195886]
Predicted Effect probably benign
Transcript: ENSMUST00000095410
AA Change: R49H

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000093059
Gene: ENSMUSG00000037957
AA Change: R49H

DomainStartEndE-ValueType
WD40 140 178 2.66e0 SMART
WD40 209 248 4.95e-4 SMART
WD40 251 290 1.47e-6 SMART
WD40 293 382 8.59e-1 SMART
Blast:WD40 464 559 2e-36 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191611
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191983
Predicted Effect possibly damaging
Transcript: ENSMUST00000192870
AA Change: R49H

PolyPhen 2 Score 0.680 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000141887
Gene: ENSMUSG00000037957
AA Change: R49H

DomainStartEndE-ValueType
Blast:WD40 89 131 1e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000193053
AA Change: R49H

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000141678
Gene: ENSMUSG00000037957
AA Change: R49H

DomainStartEndE-ValueType
Blast:WD40 89 131 2e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000195886
SMART Domains Protein: ENSMUSP00000142157
Gene: ENSMUSG00000037957

DomainStartEndE-ValueType
Blast:WD40 29 71 1e-16 BLAST
Meta Mutation Damage Score 0.1634 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 95% (52/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD repeat-containing protein that functions to preserve and regulate the activity of the USP12-UAF1 deubiquitinating enzyme complex. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik C G 6: 96,165,283 W260S possibly damaging Het
Adamts7 G T 9: 90,188,361 R585L probably damaging Het
Adamtsl5 C T 10: 80,345,322 R75Q probably null Het
Ankrd26 T A 6: 118,507,821 Q1485L probably damaging Het
Apbb2 G A 5: 66,302,604 R717* probably null Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Atp8b5 A G 4: 43,365,591 E735G probably damaging Het
Bcl11b A T 12: 107,917,425 probably null Het
C4b A G 17: 34,742,855 I139T probably damaging Het
Ccpg1 C A 9: 73,012,167 Q355K probably benign Het
Cdk8 A T 5: 146,299,449 probably benign Het
Ctif T C 18: 75,435,270 H599R probably benign Het
Degs1 A G 1: 182,282,627 I26T possibly damaging Het
Dnajc4 T C 19: 6,989,840 N72S probably damaging Het
Ecd A G 14: 20,324,564 S503P probably damaging Het
Gm1141 T C X: 71,939,555 C378R possibly damaging Het
Gm3486 G A 14: 41,486,386 L123F probably benign Het
Inpp5f C T 7: 128,679,699 probably benign Het
Irx4 A T 13: 73,265,543 Q44L probably benign Het
Krt9 T A 11: 100,188,649 Y639F unknown Het
Lgals9 C A 11: 78,973,107 V71L possibly damaging Het
Mdga1 T C 17: 29,833,343 N143S probably benign Het
Ndufs4 A T 13: 114,307,854 S129R probably benign Het
Oog2 A G 4: 144,193,953 probably benign Het
Orm2 T A 4: 63,363,985 F133L probably null Het
Pidd1 A G 7: 141,441,366 V333A possibly damaging Het
Ppp4r3a A G 12: 101,055,619 F341L probably damaging Het
Rab11fip1 A T 8: 27,152,147 S875T probably damaging Het
Rpap1 C T 2: 119,774,179 R416H probably damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Snx22 T C 9: 66,068,211 Y92C probably damaging Het
Srgn A G 10: 62,497,834 F55L possibly damaging Het
Swt1 A T 1: 151,403,044 V454E probably damaging Het
Tmem54 G A 4: 129,110,711 R151Q probably damaging Het
Tns1 T A 1: 73,914,631 N1848Y probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Top2b A G 14: 16,384,491 N80S probably benign Het
Trim7 T C 11: 48,848,093 V313A probably benign Het
Uaca A G 9: 60,871,753 S1141G probably benign Het
Ubr3 T C 2: 69,959,669 probably null Het
Utp20 A G 10: 88,761,867 V121A probably benign Het
Ylpm1 T C 12: 85,057,403 probably benign Het
Zfp398 A T 6: 47,835,909 T5S probably benign Het
Zfp410 G A 12: 84,327,432 R181H probably damaging Het
Zfp523 C T 17: 28,202,283 A367V probably benign Het
Zfp748 G A 13: 67,542,106 S345L possibly damaging Het
Other mutations in Wdr20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Wdr20 APN 12 110779449 nonsense probably null
IGL01663:Wdr20 APN 12 110793514 missense probably damaging 1.00
IGL02385:Wdr20 APN 12 110793223 missense probably benign
IGL02710:Wdr20 APN 12 110793110 splice site probably benign
IGL02993:Wdr20 APN 12 110794308 nonsense probably null
R1500:Wdr20 UTSW 12 110794030 missense probably benign
R1897:Wdr20 UTSW 12 110793723 missense probably benign
R2006:Wdr20 UTSW 12 110793568 missense probably damaging 1.00
R3615:Wdr20 UTSW 12 110793939 missense probably benign
R3616:Wdr20 UTSW 12 110793939 missense probably benign
R4023:Wdr20 UTSW 12 110793516 missense probably benign 0.01
R4026:Wdr20 UTSW 12 110793516 missense probably benign 0.01
R4868:Wdr20 UTSW 12 110738234 missense probably damaging 1.00
R6126:Wdr20 UTSW 12 110794102 missense probably benign
R6282:Wdr20 UTSW 12 110797009 unclassified probably benign
R6867:Wdr20 UTSW 12 110793699 missense probably benign
R7081:Wdr20 UTSW 12 110803450 missense possibly damaging 0.46
R7842:Wdr20 UTSW 12 110738215 missense probably benign 0.01
R7925:Wdr20 UTSW 12 110738215 missense probably benign 0.01
R8045:Wdr20 UTSW 12 110793319 missense not run
Predicted Primers PCR Primer
(F):5'- TTAGGGCAGGATGAACGCTG -3'
(R):5'- GGCCCACTCAAAAGTACAAGTG -3'

Sequencing Primer
(F):5'- AACGCTGCTTTCCAAGATGG -3'
(R):5'- AAGTACAAGTGCCGGCC -3'
Posted On2015-05-14