Incidental Mutation 'R4157:Ndufs4'
ID315601
Institutional Source Beutler Lab
Gene Symbol Ndufs4
Ensembl Gene ENSMUSG00000021764
Gene NameNADH dehydrogenase (ubiquinone) Fe-S protein 4
SynonymsC1-18k, 6720411N02Rik
MMRRC Submission 041000-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R4157 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location114287795-114388258 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 114307854 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 129 (S129R)
Ref Sequence ENSEMBL: ENSMUSP00000022286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022286] [ENSMUST00000225035] [ENSMUST00000232101]
Predicted Effect probably benign
Transcript: ENSMUST00000022286
AA Change: S129R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000022286
Gene: ENSMUSG00000021764
AA Change: S129R

DomainStartEndE-ValueType
Pfam:ETC_C1_NDUFA4 76 170 8.3e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000225035
Predicted Effect probably benign
Transcript: ENSMUST00000225707
Predicted Effect probably benign
Transcript: ENSMUST00000232101
Meta Mutation Damage Score 0.0579 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 95% (52/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an nuclear-encoded accessory subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (complex I, or NADH:ubiquinone oxidoreductase). Complex I removes electrons from NADH and passes them to the electron acceptor ubiquinone. Mutations in this gene can cause mitochondrial complex I deficiencies such as Leigh syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit growth retardation, lethargy, loss of motor skills, blindness and decreased mitochondrial CI complex activity beginning at 5 weeks of age followed by death at week 7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik C G 6: 96,165,283 W260S possibly damaging Het
Adamts7 G T 9: 90,188,361 R585L probably damaging Het
Adamtsl5 C T 10: 80,345,322 R75Q probably null Het
Ankrd26 T A 6: 118,507,821 Q1485L probably damaging Het
Apbb2 G A 5: 66,302,604 R717* probably null Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Atp8b5 A G 4: 43,365,591 E735G probably damaging Het
Bcl11b A T 12: 107,917,425 probably null Het
C4b A G 17: 34,742,855 I139T probably damaging Het
Ccpg1 C A 9: 73,012,167 Q355K probably benign Het
Cdk8 A T 5: 146,299,449 probably benign Het
Ctif T C 18: 75,435,270 H599R probably benign Het
Degs1 A G 1: 182,282,627 I26T possibly damaging Het
Dnajc4 T C 19: 6,989,840 N72S probably damaging Het
Ecd A G 14: 20,324,564 S503P probably damaging Het
Gm1141 T C X: 71,939,555 C378R possibly damaging Het
Gm3486 G A 14: 41,486,386 L123F probably benign Het
Inpp5f C T 7: 128,679,699 probably benign Het
Irx4 A T 13: 73,265,543 Q44L probably benign Het
Krt9 T A 11: 100,188,649 Y639F unknown Het
Lgals9 C A 11: 78,973,107 V71L possibly damaging Het
Mdga1 T C 17: 29,833,343 N143S probably benign Het
Oog2 A G 4: 144,193,953 probably benign Het
Orm2 T A 4: 63,363,985 F133L probably null Het
Pidd1 A G 7: 141,441,366 V333A possibly damaging Het
Ppp4r3a A G 12: 101,055,619 F341L probably damaging Het
Rab11fip1 A T 8: 27,152,147 S875T probably damaging Het
Rpap1 C T 2: 119,774,179 R416H probably damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Snx22 T C 9: 66,068,211 Y92C probably damaging Het
Srgn A G 10: 62,497,834 F55L possibly damaging Het
Swt1 A T 1: 151,403,044 V454E probably damaging Het
Tmem54 G A 4: 129,110,711 R151Q probably damaging Het
Tns1 T A 1: 73,914,631 N1848Y probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Top2b A G 14: 16,384,491 N80S probably benign Het
Trim7 T C 11: 48,848,093 V313A probably benign Het
Uaca A G 9: 60,871,753 S1141G probably benign Het
Ubr3 T C 2: 69,959,669 probably null Het
Utp20 A G 10: 88,761,867 V121A probably benign Het
Wdr20 G A 12: 110,738,174 R49H possibly damaging Het
Ylpm1 T C 12: 85,057,403 probably benign Het
Zfp398 A T 6: 47,835,909 T5S probably benign Het
Zfp410 G A 12: 84,327,432 R181H probably damaging Het
Zfp523 C T 17: 28,202,283 A367V probably benign Het
Zfp748 G A 13: 67,542,106 S345L possibly damaging Het
Other mutations in Ndufs4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00568:Ndufs4 APN 13 114307870 missense probably null 0.35
IGL03081:Ndufs4 APN 13 114307837 missense possibly damaging 0.52
R2157:Ndufs4 UTSW 13 114316978 missense probably damaging 0.99
R4155:Ndufs4 UTSW 13 114307854 missense probably benign 0.00
R4156:Ndufs4 UTSW 13 114307854 missense probably benign 0.00
R8021:Ndufs4 UTSW 13 114307815 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGTGTAGCCATCTAAGTATCTGTCC -3'
(R):5'- AGTCACTTTGGGACTCTTCTGG -3'

Sequencing Primer
(F):5'- TTCTGAGTTCAAGGACAGCC -3'
(R):5'- CTTCTGGAGTTTTGTAATTCAGAGC -3'
Posted On2015-05-14