Incidental Mutation 'R4157:C4b'
ID315608
Institutional Source Beutler Lab
Gene Symbol C4b
Ensembl Gene ENSMUSG00000073418
Gene Namecomplement component 4B (Chido blood group)
SynonymsC4, Ss
MMRRC Submission 041000-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4157 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location34728380-34743882 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34742855 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 139 (I139T)
Ref Sequence ENSEMBL: ENSMUSP00000069418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069507]
Predicted Effect probably damaging
Transcript: ENSMUST00000069507
AA Change: I139T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418
AA Change: I139T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:A2M_N 138 231 2e-19 PFAM
A2M_N_2 470 609 2.87e-26 SMART
ANATO 700 734 3.58e-12 SMART
low complexity region 761 771 N/A INTRINSIC
A2M 779 867 1.46e-27 SMART
Pfam:Thiol-ester_cl 995 1024 7.7e-13 PFAM
Pfam:A2M_comp 1047 1313 1.3e-82 PFAM
low complexity region 1441 1447 N/A INTRINSIC
A2M_recep 1475 1564 1.03e-36 SMART
C345C 1608 1720 5.69e-40 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174597
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 95% (52/55)
MGI Phenotype PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik C G 6: 96,165,283 W260S possibly damaging Het
Adamts7 G T 9: 90,188,361 R585L probably damaging Het
Adamtsl5 C T 10: 80,345,322 R75Q probably null Het
Ankrd26 T A 6: 118,507,821 Q1485L probably damaging Het
Apbb2 G A 5: 66,302,604 R717* probably null Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Atp8b5 A G 4: 43,365,591 E735G probably damaging Het
Bcl11b A T 12: 107,917,425 probably null Het
Ccpg1 C A 9: 73,012,167 Q355K probably benign Het
Cdk8 A T 5: 146,299,449 probably benign Het
Ctif T C 18: 75,435,270 H599R probably benign Het
Degs1 A G 1: 182,282,627 I26T possibly damaging Het
Dnajc4 T C 19: 6,989,840 N72S probably damaging Het
Ecd A G 14: 20,324,564 S503P probably damaging Het
Gm1141 T C X: 71,939,555 C378R possibly damaging Het
Gm3486 G A 14: 41,486,386 L123F probably benign Het
Inpp5f C T 7: 128,679,699 probably benign Het
Irx4 A T 13: 73,265,543 Q44L probably benign Het
Krt9 T A 11: 100,188,649 Y639F unknown Het
Lgals9 C A 11: 78,973,107 V71L possibly damaging Het
Mdga1 T C 17: 29,833,343 N143S probably benign Het
Ndufs4 A T 13: 114,307,854 S129R probably benign Het
Oog2 A G 4: 144,193,953 probably benign Het
Orm2 T A 4: 63,363,985 F133L probably null Het
Pidd1 A G 7: 141,441,366 V333A possibly damaging Het
Ppp4r3a A G 12: 101,055,619 F341L probably damaging Het
Rab11fip1 A T 8: 27,152,147 S875T probably damaging Het
Rpap1 C T 2: 119,774,179 R416H probably damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Snx22 T C 9: 66,068,211 Y92C probably damaging Het
Srgn A G 10: 62,497,834 F55L possibly damaging Het
Swt1 A T 1: 151,403,044 V454E probably damaging Het
Tmem54 G A 4: 129,110,711 R151Q probably damaging Het
Tns1 T A 1: 73,914,631 N1848Y probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Top2b A G 14: 16,384,491 N80S probably benign Het
Trim7 T C 11: 48,848,093 V313A probably benign Het
Uaca A G 9: 60,871,753 S1141G probably benign Het
Ubr3 T C 2: 69,959,669 probably null Het
Utp20 A G 10: 88,761,867 V121A probably benign Het
Wdr20 G A 12: 110,738,174 R49H possibly damaging Het
Ylpm1 T C 12: 85,057,403 probably benign Het
Zfp398 A T 6: 47,835,909 T5S probably benign Het
Zfp410 G A 12: 84,327,432 R181H probably damaging Het
Zfp523 C T 17: 28,202,283 A367V probably benign Het
Zfp748 G A 13: 67,542,106 S345L possibly damaging Het
Other mutations in C4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:C4b APN 17 34734428 missense probably damaging 1.00
IGL00433:C4b APN 17 34742041 missense possibly damaging 0.75
IGL00471:C4b APN 17 34734429 missense probably damaging 1.00
IGL00515:C4b APN 17 34728891 missense probably damaging 1.00
IGL01599:C4b APN 17 34743019 splice site probably benign
IGL01761:C4b APN 17 34739938 missense possibly damaging 0.56
IGL02004:C4b APN 17 34739010 unclassified probably benign
IGL02215:C4b APN 17 34734491 missense probably damaging 1.00
IGL02517:C4b APN 17 34734408 missense probably benign 0.01
IGL02926:C4b APN 17 34730712 missense possibly damaging 0.95
IGL03031:C4b APN 17 34731130 missense possibly damaging 0.47
IGL03057:C4b APN 17 34737764 unclassified probably benign
IGL03165:C4b APN 17 34739955 missense probably benign 0.13
IGL03380:C4b APN 17 34740286 missense probably benign 0.01
Aspiration UTSW 17 34734442 missense probably benign 0.00
Inspiration UTSW 17 34732166 splice site probably null
Peroration UTSW 17 34729399 critical splice donor site probably null
perspiration UTSW 17 34729831 missense probably damaging 1.00
FR4548:C4b UTSW 17 34740997 missense probably benign 0.00
PIT4142001:C4b UTSW 17 34733701 missense probably benign 0.01
R0064:C4b UTSW 17 34738856 missense probably damaging 1.00
R0113:C4b UTSW 17 34741240 missense probably damaging 0.98
R0143:C4b UTSW 17 34734219 unclassified probably benign
R0254:C4b UTSW 17 34734776 missense probably benign 0.00
R0320:C4b UTSW 17 34733161 missense probably benign 0.01
R0391:C4b UTSW 17 34735614 splice site probably benign
R0399:C4b UTSW 17 34728869 missense probably damaging 1.00
R0467:C4b UTSW 17 34736127 missense probably benign 0.01
R0549:C4b UTSW 17 34735415 missense probably damaging 1.00
R0561:C4b UTSW 17 34734417 missense probably damaging 0.99
R0662:C4b UTSW 17 34730888 missense probably damaging 1.00
R0941:C4b UTSW 17 34740055 missense probably benign
R1161:C4b UTSW 17 34729593 missense probably damaging 1.00
R1169:C4b UTSW 17 34742972 missense probably benign 0.14
R1186:C4b UTSW 17 34736309 missense possibly damaging 0.47
R1310:C4b UTSW 17 34729593 missense probably damaging 1.00
R1398:C4b UTSW 17 34730719 unclassified probably benign
R1472:C4b UTSW 17 34743769 nonsense probably null
R1496:C4b UTSW 17 34740021 missense probably benign 0.30
R1544:C4b UTSW 17 34738967 missense probably benign 0.13
R1588:C4b UTSW 17 34741025 missense probably benign
R1645:C4b UTSW 17 34740597 missense probably damaging 1.00
R1664:C4b UTSW 17 34732978 missense probably damaging 1.00
R1678:C4b UTSW 17 34743650 missense probably benign 0.05
R1710:C4b UTSW 17 34743664 splice site probably benign
R1713:C4b UTSW 17 34729271 splice site probably benign
R1770:C4b UTSW 17 34736927 missense possibly damaging 0.78
R1859:C4b UTSW 17 34735553 missense probably benign
R1924:C4b UTSW 17 34729657 missense probably damaging 1.00
R2057:C4b UTSW 17 34728620 missense probably damaging 1.00
R2060:C4b UTSW 17 34736101 missense probably damaging 1.00
R2184:C4b UTSW 17 34737702 missense probably benign 0.27
R2306:C4b UTSW 17 34728518 missense probably benign 0.00
R2363:C4b UTSW 17 34736058 splice site probably benign
R2365:C4b UTSW 17 34736058 splice site probably benign
R2379:C4b UTSW 17 34735743 missense possibly damaging 0.81
R2860:C4b UTSW 17 34734758 missense probably damaging 0.99
R2861:C4b UTSW 17 34734758 missense probably damaging 0.99
R3551:C4b UTSW 17 34741872 missense possibly damaging 0.75
R3765:C4b UTSW 17 34729840 missense probably damaging 0.98
R4299:C4b UTSW 17 34731144 missense possibly damaging 0.52
R4365:C4b UTSW 17 34734743 missense possibly damaging 0.65
R4411:C4b UTSW 17 34728864 missense probably damaging 1.00
R4613:C4b UTSW 17 34734551 missense probably benign 0.12
R4784:C4b UTSW 17 34733406 missense probably benign 0.00
R4790:C4b UTSW 17 34734143 missense probably benign 0.01
R4831:C4b UTSW 17 34736890 splice site probably null
R4879:C4b UTSW 17 34743647 missense probably damaging 0.99
R5036:C4b UTSW 17 34740445 critical splice acceptor site probably null
R5361:C4b UTSW 17 34741238 missense probably benign 0.15
R5384:C4b UTSW 17 34737661 missense possibly damaging 0.89
R5518:C4b UTSW 17 34734442 missense probably benign 0.00
R5590:C4b UTSW 17 34740335 missense probably damaging 0.98
R5643:C4b UTSW 17 34742417 missense probably benign 0.01
R5644:C4b UTSW 17 34742417 missense probably benign 0.01
R5833:C4b UTSW 17 34730673 missense probably damaging 1.00
R5931:C4b UTSW 17 34729193 missense probably damaging 0.99
R6178:C4b UTSW 17 34733406 missense probably benign 0.00
R6209:C4b UTSW 17 34741087 missense possibly damaging 0.93
R6225:C4b UTSW 17 34738874 missense possibly damaging 0.64
R6518:C4b UTSW 17 34734205 missense probably damaging 0.98
R6613:C4b UTSW 17 34733565 missense probably damaging 0.99
R6781:C4b UTSW 17 34742954 missense probably damaging 0.99
R6807:C4b UTSW 17 34730956 missense probably benign 0.17
R6858:C4b UTSW 17 34729831 missense probably damaging 1.00
R6962:C4b UTSW 17 34732166 splice site probably null
R7068:C4b UTSW 17 34733477 missense probably damaging 1.00
R7081:C4b UTSW 17 34735443 missense probably benign 0.27
R7105:C4b UTSW 17 34730911 missense possibly damaging 0.52
R7211:C4b UTSW 17 34735534 missense possibly damaging 0.92
R7296:C4b UTSW 17 34743659 missense probably damaging 1.00
R7314:C4b UTSW 17 34740356 missense probably benign
R7330:C4b UTSW 17 34730472 missense probably damaging 1.00
R7397:C4b UTSW 17 34742390 missense possibly damaging 0.80
R7437:C4b UTSW 17 34734733 missense probably benign 0.10
R7490:C4b UTSW 17 34731080 nonsense probably null
R7597:C4b UTSW 17 34739675 missense probably benign
R7633:C4b UTSW 17 34729399 critical splice donor site probably null
R7900:C4b UTSW 17 34739777 missense probably benign 0.03
R7910:C4b UTSW 17 34740352 missense probably benign 0.00
R7923:C4b UTSW 17 34742380 missense probably damaging 1.00
R7960:C4b UTSW 17 34741278 splice site probably null
R8420:C4b UTSW 17 34734539 missense probably damaging 0.97
R8467:C4b UTSW 17 34732813 missense possibly damaging 0.51
R8558:C4b UTSW 17 34736567 missense probably damaging 1.00
R8725:C4b UTSW 17 34734485 missense probably damaging 1.00
R8727:C4b UTSW 17 34734485 missense probably damaging 1.00
Z1176:C4b UTSW 17 34731147 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GACAACGGGGACTTAACTGC -3'
(R):5'- CCTACCTTAGGCTCTGTATTGG -3'

Sequencing Primer
(F):5'- ACGGGGACTTAACTGCTAATC -3'
(R):5'- ACCTTAGGCTCTGTATTGGGTTCC -3'
Posted On2015-05-14