Incidental Mutation 'R4158:Kcne4'
ID315612
Institutional Source Beutler Lab
Gene Symbol Kcne4
Ensembl Gene ENSMUSG00000047330
Gene Namepotassium voltage-gated channel, Isk-related subfamily, gene 4
SynonymsMiRP3
MMRRC Submission 041001-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.212) question?
Stock #R4158 (G1)
Quality Score215
Status Validated
Chromosome1
Chromosomal Location78816758-78820028 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78818102 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 156 (N156D)
Ref Sequence ENSEMBL: ENSMUSP00000055415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057262] [ENSMUST00000187432]
Predicted Effect probably benign
Transcript: ENSMUST00000057262
AA Change: N156D

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000055415
Gene: ENSMUSG00000047330
AA Change: N156D

DomainStartEndE-ValueType
Pfam:ISK_Channel 4 86 2.3e-11 PFAM
low complexity region 124 131 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186681
Predicted Effect probably benign
Transcript: ENSMUST00000187432
SMART Domains Protein: ENSMUSP00000140235
Gene: ENSMUSG00000047330

DomainStartEndE-ValueType
Pfam:ISK_Channel 6 64 2.5e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189296
Meta Mutation Damage Score 0.0676 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, isk-related subfamily. This member is a type I membrane protein, and a beta subunit that assembles with a potassium channel alpha-subunit to modulate the gating kinetics and enhance stability of the multimeric complex. This gene is prominently expressed in the embryo and in adult uterus. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 43,650,817 H597R probably damaging Het
Adgrf4 G T 17: 42,667,677 H258Q probably benign Het
Ankrd1 T A 19: 36,117,873 K138N probably damaging Het
Arg1 T C 10: 24,922,677 E25G probably damaging Het
Arhgef19 T C 4: 141,246,349 I49T possibly damaging Het
Bsn A G 9: 108,112,946 V1869A possibly damaging Het
Cep350 G A 1: 155,932,875 R652W probably damaging Het
Cyp19a1 G A 9: 54,186,696 T94I probably damaging Het
Dnajc13 G A 9: 104,190,442 L1173F probably damaging Het
Dse A G 10: 34,153,334 F587L probably damaging Het
Efcab14 A C 4: 115,740,397 D63A probably damaging Het
Eomes A G 9: 118,478,963 T35A probably benign Het
Fbxl20 T C 11: 98,095,394 probably benign Het
Flcn T C 11: 59,801,121 N234S probably benign Het
Gm20939 A T 17: 94,876,734 Y270F possibly damaging Het
Ikzf4 A T 10: 128,643,736 probably benign Het
Iltifb T C 10: 118,293,132 T151A probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lrrc45 A T 11: 120,718,446 D377V possibly damaging Het
Magi3 T C 3: 104,050,961 K603E probably damaging Het
Mocos T C 18: 24,674,246 I345T probably damaging Het
Nox4 A T 7: 87,396,824 H557L possibly damaging Het
Oasl1 A G 5: 114,937,014 K378E possibly damaging Het
Pla2r1 A T 2: 60,422,622 I1375K probably damaging Het
Ppp6r3 T A 19: 3,512,037 H208L probably damaging Het
Ptprz1 A T 6: 23,001,684 K1258* probably null Het
Ptprz1 T C 6: 23,022,205 I844T possibly damaging Het
Sdk1 A G 5: 142,114,399 I1395V probably benign Het
Sec31b T C 19: 44,525,186 N470S probably benign Het
Slc26a7 T C 4: 14,544,197 T369A probably benign Het
Tex14 T G 11: 87,516,769 S900R probably benign Het
Ush2a G A 1: 188,728,710 V2723M probably damaging Het
Vat1l T A 8: 114,371,729 M413K probably benign Het
Zfp981 T A 4: 146,537,882 H421Q probably benign Het
Zfp981 C A 4: 146,537,623 P335Q probably benign Het
Other mutations in Kcne4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01618:Kcne4 APN 1 78817808 missense possibly damaging 0.89
IGL03047:Kcne4 UTSW 1 78817778 missense possibly damaging 0.64
R2091:Kcne4 UTSW 1 78817907 missense probably benign 0.00
R2426:Kcne4 UTSW 1 78817971 missense possibly damaging 0.94
R3405:Kcne4 UTSW 1 78817971 missense possibly damaging 0.94
R3406:Kcne4 UTSW 1 78817971 missense possibly damaging 0.94
R4159:Kcne4 UTSW 1 78818102 missense probably benign 0.01
R4414:Kcne4 UTSW 1 78817934 missense probably benign
R6959:Kcne4 UTSW 1 78817886 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCATGATGCTGAATATGCTGCAG -3'
(R):5'- ATGAGTCCCACAGGAACCTC -3'

Sequencing Primer
(F):5'- CTGAATATGCTGCAGGAGAGTGTG -3'
(R):5'- GAACCTCAAGGACTGCAGCTG -3'
Posted On2015-05-14