Incidental Mutation 'R4158:Slc26a7'
ID315617
Institutional Source Beutler Lab
Gene Symbol Slc26a7
Ensembl Gene ENSMUSG00000040569
Gene Namesolute carrier family 26, member 7
Synonyms
MMRRC Submission 041001-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R4158 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location14502430-14621805 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14544197 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 369 (T369A)
Ref Sequence ENSEMBL: ENSMUSP00000041789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042221]
Predicted Effect probably benign
Transcript: ENSMUST00000042221
AA Change: T369A

PolyPhen 2 Score 0.378 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000041789
Gene: ENSMUSG00000040569
AA Change: T369A

DomainStartEndE-ValueType
Pfam:Sulfate_transp 47 444 6.9e-95 PFAM
transmembrane domain 445 467 N/A INTRINSIC
Pfam:STAS 493 637 4.7e-19 PFAM
Meta Mutation Damage Score 0.6613 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one member of a family of sulfate/anion transporter genes. Family members are well conserved in gene structure and protein length yet have markedly different tissue expression patterns. This gene has abundant and specific expression in the kidney. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice deficient for this marker have a reduce arterial pH and reduced serum bicarbonate. Urine is more concentrated and has an elevated pH. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 43,650,817 H597R probably damaging Het
Adgrf4 G T 17: 42,667,677 H258Q probably benign Het
Ankrd1 T A 19: 36,117,873 K138N probably damaging Het
Arg1 T C 10: 24,922,677 E25G probably damaging Het
Arhgef19 T C 4: 141,246,349 I49T possibly damaging Het
Bsn A G 9: 108,112,946 V1869A possibly damaging Het
Cep350 G A 1: 155,932,875 R652W probably damaging Het
Cyp19a1 G A 9: 54,186,696 T94I probably damaging Het
Dnajc13 G A 9: 104,190,442 L1173F probably damaging Het
Dse A G 10: 34,153,334 F587L probably damaging Het
Efcab14 A C 4: 115,740,397 D63A probably damaging Het
Eomes A G 9: 118,478,963 T35A probably benign Het
Fbxl20 T C 11: 98,095,394 probably benign Het
Flcn T C 11: 59,801,121 N234S probably benign Het
Gm20939 A T 17: 94,876,734 Y270F possibly damaging Het
Ikzf4 A T 10: 128,643,736 probably benign Het
Iltifb T C 10: 118,293,132 T151A probably damaging Het
Kcne4 A G 1: 78,818,102 N156D probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lrrc45 A T 11: 120,718,446 D377V possibly damaging Het
Magi3 T C 3: 104,050,961 K603E probably damaging Het
Mocos T C 18: 24,674,246 I345T probably damaging Het
Nox4 A T 7: 87,396,824 H557L possibly damaging Het
Oasl1 A G 5: 114,937,014 K378E possibly damaging Het
Pla2r1 A T 2: 60,422,622 I1375K probably damaging Het
Ppp6r3 T A 19: 3,512,037 H208L probably damaging Het
Ptprz1 A T 6: 23,001,684 K1258* probably null Het
Ptprz1 T C 6: 23,022,205 I844T possibly damaging Het
Sdk1 A G 5: 142,114,399 I1395V probably benign Het
Sec31b T C 19: 44,525,186 N470S probably benign Het
Tex14 T G 11: 87,516,769 S900R probably benign Het
Ush2a G A 1: 188,728,710 V2723M probably damaging Het
Vat1l T A 8: 114,371,729 M413K probably benign Het
Zfp981 C A 4: 146,537,623 P335Q probably benign Het
Zfp981 T A 4: 146,537,882 H421Q probably benign Het
Other mutations in Slc26a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Slc26a7 APN 4 14548403 splice site probably benign
IGL00943:Slc26a7 APN 4 14506477 missense probably benign 0.01
IGL01878:Slc26a7 APN 4 14519388 splice site probably null
IGL02698:Slc26a7 APN 4 14593867 missense possibly damaging 0.93
IGL03133:Slc26a7 APN 4 14532576 missense possibly damaging 0.49
R0200:Slc26a7 UTSW 4 14621317 missense probably benign 0.04
R0240:Slc26a7 UTSW 4 14532651 missense probably damaging 1.00
R0240:Slc26a7 UTSW 4 14532651 missense probably damaging 1.00
R0608:Slc26a7 UTSW 4 14621317 missense probably benign 0.04
R0833:Slc26a7 UTSW 4 14593873 missense probably damaging 1.00
R1496:Slc26a7 UTSW 4 14506489 missense probably benign 0.01
R1592:Slc26a7 UTSW 4 14552470 missense probably benign 0.09
R1656:Slc26a7 UTSW 4 14621221 missense possibly damaging 0.90
R1758:Slc26a7 UTSW 4 14548491 missense possibly damaging 0.58
R1861:Slc26a7 UTSW 4 14522873 missense probably benign
R2429:Slc26a7 UTSW 4 14506399 splice site probably benign
R2850:Slc26a7 UTSW 4 14593806 splice site probably benign
R3442:Slc26a7 UTSW 4 14565511 missense probably benign 0.11
R4160:Slc26a7 UTSW 4 14544197 missense probably benign 0.38
R4721:Slc26a7 UTSW 4 14510261 splice site probably null
R4727:Slc26a7 UTSW 4 14590477 missense probably damaging 1.00
R4825:Slc26a7 UTSW 4 14546309 missense probably benign 0.18
R4992:Slc26a7 UTSW 4 14565508 missense probably damaging 1.00
R5024:Slc26a7 UTSW 4 14532572 missense possibly damaging 0.91
R5344:Slc26a7 UTSW 4 14519402 missense probably benign 0.00
R5373:Slc26a7 UTSW 4 14546447 missense probably damaging 0.99
R5540:Slc26a7 UTSW 4 14506621 missense probably benign
R6046:Slc26a7 UTSW 4 14505471 missense probably benign 0.24
R6320:Slc26a7 UTSW 4 14524498 missense probably benign 0.01
R6685:Slc26a7 UTSW 4 14593819 missense probably damaging 1.00
R6685:Slc26a7 UTSW 4 14593820 missense probably damaging 1.00
R6880:Slc26a7 UTSW 4 14516159 missense possibly damaging 0.57
R6958:Slc26a7 UTSW 4 14506442 missense probably benign 0.00
R7000:Slc26a7 UTSW 4 14552476 missense probably benign
R7090:Slc26a7 UTSW 4 14565460 nonsense probably null
R7122:Slc26a7 UTSW 4 14533639 missense probably damaging 1.00
R7361:Slc26a7 UTSW 4 14546305 missense probably damaging 1.00
R8035:Slc26a7 UTSW 4 14621338 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- CCTGTGGAAAAGTCATTGATGGG -3'
(R):5'- TGCGGTGAATAGTAGCTGAGC -3'

Sequencing Primer
(F):5'- AAAAGTCATTGATGGGAAAAATTCG -3'
(R):5'- GTAGCTGAGCATAAACAAGCTTC -3'
Posted On2015-05-14