Incidental Mutation 'R4158:Nox4'
Institutional Source Beutler Lab
Gene Symbol Nox4
Ensembl Gene ENSMUSG00000030562
Gene NameNADPH oxidase 4
MMRRC Submission 041001-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4158 (G1)
Quality Score225
Status Validated
Chromosomal Location87246096-87398710 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87396824 bp
Amino Acid Change Histidine to Leucine at position 557 (H557L)
Ref Sequence ENSEMBL: ENSMUSP00000032781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032781] [ENSMUST00000068829] [ENSMUST00000126887] [ENSMUST00000136577] [ENSMUST00000144267]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032781
AA Change: H557L

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000032781
Gene: ENSMUSG00000030562
AA Change: H557L

transmembrane domain 13 35 N/A INTRINSIC
Pfam:Ferric_reduct 58 205 8.3e-21 PFAM
Pfam:FAD_binding_8 306 417 2.8e-17 PFAM
Pfam:NAD_binding_6 423 561 7.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068829
SMART Domains Protein: ENSMUSP00000070039
Gene: ENSMUSG00000030562

transmembrane domain 13 35 N/A INTRINSIC
Pfam:Ferric_reduct 58 205 5.3e-27 PFAM
Pfam:FAD_binding_8 306 417 5.5e-17 PFAM
Pfam:NAD_binding_6 423 539 4.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126887
SMART Domains Protein: ENSMUSP00000138336
Gene: ENSMUSG00000030562

transmembrane domain 13 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136577
SMART Domains Protein: ENSMUSP00000138274
Gene: ENSMUSG00000030562

transmembrane domain 13 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144267
SMART Domains Protein: ENSMUSP00000138143
Gene: ENSMUSG00000030562

transmembrane domain 13 35 N/A INTRINSIC
Meta Mutation Damage Score 0.2831 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NOX-family of enzymes that functions as the catalytic subunit the NADPH oxidase complex. The encoded protein is localized to non-phagocytic cells where it acts as an oxygen sensor and catalyzes the reduction of molecular oxygen to various reactive oxygen species (ROS). The ROS generated by this protein have been implicated in numerous biological functions including signal transduction, cell differentiation and tumor cell growth. A pseudogene has been identified on the other arm of chromosome 11. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for a null allele display increased heart damage following pressure overload. Mice with a cardiomyocyte specific deletion show decreased damage following pressure overload. Mice homozygous for a different knock-out allele exhibit decreased suseptibility to bleomycin-induced fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 43,650,817 H597R probably damaging Het
Adgrf4 G T 17: 42,667,677 H258Q probably benign Het
Ankrd1 T A 19: 36,117,873 K138N probably damaging Het
Arg1 T C 10: 24,922,677 E25G probably damaging Het
Arhgef19 T C 4: 141,246,349 I49T possibly damaging Het
Bsn A G 9: 108,112,946 V1869A possibly damaging Het
Cep350 G A 1: 155,932,875 R652W probably damaging Het
Cyp19a1 G A 9: 54,186,696 T94I probably damaging Het
Dnajc13 G A 9: 104,190,442 L1173F probably damaging Het
Dse A G 10: 34,153,334 F587L probably damaging Het
Efcab14 A C 4: 115,740,397 D63A probably damaging Het
Eomes A G 9: 118,478,963 T35A probably benign Het
Fbxl20 T C 11: 98,095,394 probably benign Het
Flcn T C 11: 59,801,121 N234S probably benign Het
Gm20939 A T 17: 94,876,734 Y270F possibly damaging Het
Ikzf4 A T 10: 128,643,736 probably benign Het
Iltifb T C 10: 118,293,132 T151A probably damaging Het
Kcne4 A G 1: 78,818,102 N156D probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lrrc45 A T 11: 120,718,446 D377V possibly damaging Het
Magi3 T C 3: 104,050,961 K603E probably damaging Het
Mocos T C 18: 24,674,246 I345T probably damaging Het
Oasl1 A G 5: 114,937,014 K378E possibly damaging Het
Pla2r1 A T 2: 60,422,622 I1375K probably damaging Het
Ppp6r3 T A 19: 3,512,037 H208L probably damaging Het
Ptprz1 A T 6: 23,001,684 K1258* probably null Het
Ptprz1 T C 6: 23,022,205 I844T possibly damaging Het
Sdk1 A G 5: 142,114,399 I1395V probably benign Het
Sec31b T C 19: 44,525,186 N470S probably benign Het
Slc26a7 T C 4: 14,544,197 T369A probably benign Het
Tex14 T G 11: 87,516,769 S900R probably benign Het
Ush2a G A 1: 188,728,710 V2723M probably damaging Het
Vat1l T A 8: 114,371,729 M413K probably benign Het
Zfp981 C A 4: 146,537,623 P335Q probably benign Het
Zfp981 T A 4: 146,537,882 H421Q probably benign Het
Other mutations in Nox4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01455:Nox4 APN 7 87376216 missense possibly damaging 0.89
IGL02711:Nox4 APN 7 87396868 missense probably damaging 1.00
IGL03234:Nox4 APN 7 87317313 critical splice donor site probably null
IGL03286:Nox4 APN 7 87370141 splice site probably benign
LCD18:Nox4 UTSW 7 87243067 unclassified probably benign
PIT4151001:Nox4 UTSW 7 87304889 missense probably benign 0.02
R0717:Nox4 UTSW 7 87304890 nonsense probably null
R1033:Nox4 UTSW 7 87374413 missense probably damaging 0.99
R1135:Nox4 UTSW 7 87323789 missense probably damaging 1.00
R1333:Nox4 UTSW 7 87246864 missense possibly damaging 0.80
R1477:Nox4 UTSW 7 87295866 missense probably benign 0.16
R1489:Nox4 UTSW 7 87304889 missense probably damaging 0.99
R1579:Nox4 UTSW 7 87370023 missense probably damaging 0.98
R1669:Nox4 UTSW 7 87295889 missense probably benign 0.01
R1742:Nox4 UTSW 7 87295818 missense possibly damaging 0.82
R1900:Nox4 UTSW 7 87360796 nonsense probably null
R2112:Nox4 UTSW 7 87372008 missense probably damaging 1.00
R2192:Nox4 UTSW 7 87374380 missense probably benign 0.02
R2496:Nox4 UTSW 7 87306750 missense probably benign 0.04
R2497:Nox4 UTSW 7 87295876 nonsense probably null
R4160:Nox4 UTSW 7 87396824 missense possibly damaging 0.95
R4281:Nox4 UTSW 7 87297524 missense possibly damaging 0.77
R4685:Nox4 UTSW 7 87297508 missense probably benign 0.36
R4791:Nox4 UTSW 7 87304847 missense probably benign 0.35
R5001:Nox4 UTSW 7 87360803 missense probably damaging 0.96
R5091:Nox4 UTSW 7 87376242 missense probably damaging 1.00
R5174:Nox4 UTSW 7 87323766 missense probably benign 0.10
R5220:Nox4 UTSW 7 87374408 missense possibly damaging 0.91
R5278:Nox4 UTSW 7 87371926 missense probably damaging 1.00
R5723:Nox4 UTSW 7 87304973 intron probably benign
R5840:Nox4 UTSW 7 87360793 missense probably benign 0.00
R5852:Nox4 UTSW 7 87338964 missense probably damaging 0.98
R7516:Nox4 UTSW 7 87321697 missense probably benign
R7529:Nox4 UTSW 7 87395768 missense unknown
R7587:Nox4 UTSW 7 87317302 missense probably damaging 1.00
R7643:Nox4 UTSW 7 87323754 missense probably damaging 1.00
R7660:Nox4 UTSW 7 87370022 missense probably damaging 0.97
R7786:Nox4 UTSW 7 87295842 missense probably damaging 0.99
R7871:Nox4 UTSW 7 87314127 missense possibly damaging 0.95
R7954:Nox4 UTSW 7 87314127 missense possibly damaging 0.95
R8024:Nox4 UTSW 7 87304910 missense probably damaging 0.99
R8053:Nox4 UTSW 7 87370047 missense probably damaging 1.00
X0021:Nox4 UTSW 7 87395678 missense probably damaging 1.00
Z1177:Nox4 UTSW 7 87395712 missense unknown
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-05-14