Incidental Mutation 'R4158:Vat1l'
ID315627
Institutional Source Beutler Lab
Gene Symbol Vat1l
Ensembl Gene ENSMUSG00000046844
Gene Namevesicle amine transport protein 1 like
Synonyms
MMRRC Submission 041001-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R4158 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location114205612-114374071 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 114371729 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 413 (M413K)
Ref Sequence ENSEMBL: ENSMUSP00000053431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049509]
Predicted Effect probably benign
Transcript: ENSMUST00000049509
AA Change: M413K

PolyPhen 2 Score 0.319 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000053431
Gene: ENSMUSG00000046844
AA Change: M413K

DomainStartEndE-ValueType
Pfam:ADH_N 66 142 3.9e-14 PFAM
Pfam:ADH_zinc_N 190 302 1.4e-11 PFAM
Pfam:ADH_zinc_N_2 221 376 1.1e-14 PFAM
low complexity region 389 408 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124143
Meta Mutation Damage Score 0.1042 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (38/39)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 43,650,817 H597R probably damaging Het
Adgrf4 G T 17: 42,667,677 H258Q probably benign Het
Ankrd1 T A 19: 36,117,873 K138N probably damaging Het
Arg1 T C 10: 24,922,677 E25G probably damaging Het
Arhgef19 T C 4: 141,246,349 I49T possibly damaging Het
Bsn A G 9: 108,112,946 V1869A possibly damaging Het
Cep350 G A 1: 155,932,875 R652W probably damaging Het
Cyp19a1 G A 9: 54,186,696 T94I probably damaging Het
Dnajc13 G A 9: 104,190,442 L1173F probably damaging Het
Dse A G 10: 34,153,334 F587L probably damaging Het
Efcab14 A C 4: 115,740,397 D63A probably damaging Het
Eomes A G 9: 118,478,963 T35A probably benign Het
Fbxl20 T C 11: 98,095,394 probably benign Het
Flcn T C 11: 59,801,121 N234S probably benign Het
Gm20939 A T 17: 94,876,734 Y270F possibly damaging Het
Ikzf4 A T 10: 128,643,736 probably benign Het
Iltifb T C 10: 118,293,132 T151A probably damaging Het
Kcne4 A G 1: 78,818,102 N156D probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lrrc45 A T 11: 120,718,446 D377V possibly damaging Het
Magi3 T C 3: 104,050,961 K603E probably damaging Het
Mocos T C 18: 24,674,246 I345T probably damaging Het
Nox4 A T 7: 87,396,824 H557L possibly damaging Het
Oasl1 A G 5: 114,937,014 K378E possibly damaging Het
Pla2r1 A T 2: 60,422,622 I1375K probably damaging Het
Ppp6r3 T A 19: 3,512,037 H208L probably damaging Het
Ptprz1 A T 6: 23,001,684 K1258* probably null Het
Ptprz1 T C 6: 23,022,205 I844T possibly damaging Het
Sdk1 A G 5: 142,114,399 I1395V probably benign Het
Sec31b T C 19: 44,525,186 N470S probably benign Het
Slc26a7 T C 4: 14,544,197 T369A probably benign Het
Tex14 T G 11: 87,516,769 S900R probably benign Het
Ush2a G A 1: 188,728,710 V2723M probably damaging Het
Zfp981 C A 4: 146,537,623 P335Q probably benign Het
Zfp981 T A 4: 146,537,882 H421Q probably benign Het
Other mutations in Vat1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Vat1l APN 8 114369889 missense possibly damaging 0.89
IGL03379:Vat1l APN 8 114282266 missense probably damaging 0.98
R0504:Vat1l UTSW 8 114236579 splice site probably benign
R1222:Vat1l UTSW 8 114282361 splice site probably benign
R1418:Vat1l UTSW 8 114282361 splice site probably benign
R1859:Vat1l UTSW 8 114271301 missense probably damaging 1.00
R3777:Vat1l UTSW 8 114236800 critical splice donor site probably null
R3778:Vat1l UTSW 8 114236800 critical splice donor site probably null
R4154:Vat1l UTSW 8 114205803 missense possibly damaging 0.94
R4160:Vat1l UTSW 8 114371729 missense probably benign 0.32
R4285:Vat1l UTSW 8 114205783 missense probably damaging 0.97
R4507:Vat1l UTSW 8 114205816 missense probably benign 0.02
R5316:Vat1l UTSW 8 114284348 missense probably damaging 1.00
R6306:Vat1l UTSW 8 114371651 missense probably damaging 1.00
R7031:Vat1l UTSW 8 114271432 missense possibly damaging 0.60
R7162:Vat1l UTSW 8 114236778 missense probably damaging 0.99
R7378:Vat1l UTSW 8 114289392 missense possibly damaging 0.93
R7472:Vat1l UTSW 8 114236799 critical splice donor site probably null
R7662:Vat1l UTSW 8 114282344 missense probably damaging 1.00
RF032:Vat1l UTSW 8 114289329 missense probably damaging 1.00
RF035:Vat1l UTSW 8 114289329 missense probably damaging 1.00
X0062:Vat1l UTSW 8 114236622 missense probably damaging 1.00
X0062:Vat1l UTSW 8 114236623 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCCATGATGCTTCAGTCC -3'
(R):5'- AGGGACACAATACTGCATGG -3'

Sequencing Primer
(F):5'- ATGATGCTTCAGTCCATCTCAGTG -3'
(R):5'- GGGATTGGCACTTAATTCCAAACAC -3'
Posted On2015-05-14