Incidental Mutation 'R4158:Cyp19a1'
ID315628
Institutional Source Beutler Lab
Gene Symbol Cyp19a1
Ensembl Gene ENSMUSG00000032274
Gene Namecytochrome P450, family 19, subfamily a, polypeptide 1
SynonymsCyp19, ArKO, Int-5, aromatase, p450arom, Int5, Ar
MMRRC Submission 041001-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4158 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location54165937-54268110 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 54186696 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 94 (T94I)
Ref Sequence ENSEMBL: ENSMUSP00000034811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034811] [ENSMUST00000215736]
Predicted Effect probably damaging
Transcript: ENSMUST00000034811
AA Change: T94I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034811
Gene: ENSMUSG00000032274
AA Change: T94I

DomainStartEndE-ValueType
low complexity region 28 38 N/A INTRINSIC
Pfam:p450 46 488 1e-106 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215736
AA Change: T27I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217040
Meta Mutation Damage Score 0.6312 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and catalyzes the last steps of estrogen biosynthesis. Mutations in this gene can result in either increased or decreased aromatase activity; the associated phenotypes suggest that estrogen functions both as a sex steroid hormone and in growth or differentiation. Alternative promoter use and alternative splicing results in multiple transcript variants that have different tissue specificities. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for various mutations that inactivate the gene exhibit defects affecting fertility including impairments of ovulation, spermiogenesis and mounting behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 43,650,817 H597R probably damaging Het
Adgrf4 G T 17: 42,667,677 H258Q probably benign Het
Ankrd1 T A 19: 36,117,873 K138N probably damaging Het
Arg1 T C 10: 24,922,677 E25G probably damaging Het
Arhgef19 T C 4: 141,246,349 I49T possibly damaging Het
Bsn A G 9: 108,112,946 V1869A possibly damaging Het
Cep350 G A 1: 155,932,875 R652W probably damaging Het
Dnajc13 G A 9: 104,190,442 L1173F probably damaging Het
Dse A G 10: 34,153,334 F587L probably damaging Het
Efcab14 A C 4: 115,740,397 D63A probably damaging Het
Eomes A G 9: 118,478,963 T35A probably benign Het
Fbxl20 T C 11: 98,095,394 probably benign Het
Flcn T C 11: 59,801,121 N234S probably benign Het
Gm20939 A T 17: 94,876,734 Y270F possibly damaging Het
Ikzf4 A T 10: 128,643,736 probably benign Het
Iltifb T C 10: 118,293,132 T151A probably damaging Het
Kcne4 A G 1: 78,818,102 N156D probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lrrc45 A T 11: 120,718,446 D377V possibly damaging Het
Magi3 T C 3: 104,050,961 K603E probably damaging Het
Mocos T C 18: 24,674,246 I345T probably damaging Het
Nox4 A T 7: 87,396,824 H557L possibly damaging Het
Oasl1 A G 5: 114,937,014 K378E possibly damaging Het
Pla2r1 A T 2: 60,422,622 I1375K probably damaging Het
Ppp6r3 T A 19: 3,512,037 H208L probably damaging Het
Ptprz1 A T 6: 23,001,684 K1258* probably null Het
Ptprz1 T C 6: 23,022,205 I844T possibly damaging Het
Sdk1 A G 5: 142,114,399 I1395V probably benign Het
Sec31b T C 19: 44,525,186 N470S probably benign Het
Slc26a7 T C 4: 14,544,197 T369A probably benign Het
Tex14 T G 11: 87,516,769 S900R probably benign Het
Ush2a G A 1: 188,728,710 V2723M probably damaging Het
Vat1l T A 8: 114,371,729 M413K probably benign Het
Zfp981 C A 4: 146,537,623 P335Q probably benign Het
Zfp981 T A 4: 146,537,882 H421Q probably benign Het
Other mutations in Cyp19a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01897:Cyp19a1 APN 9 54168529 missense probably benign 0.03
IGL02885:Cyp19a1 APN 9 54171818 missense probably benign 0.25
IGL02897:Cyp19a1 APN 9 54166911 missense possibly damaging 0.95
R0384:Cyp19a1 UTSW 9 54172741 missense probably benign 0.01
R3104:Cyp19a1 UTSW 9 54186799 missense probably benign 0.00
R4116:Cyp19a1 UTSW 9 54168741 missense possibly damaging 0.94
R4160:Cyp19a1 UTSW 9 54186696 missense probably damaging 1.00
R4555:Cyp19a1 UTSW 9 54166821 missense probably damaging 0.96
R4569:Cyp19a1 UTSW 9 54193323 missense probably benign 0.06
R4570:Cyp19a1 UTSW 9 54193323 missense probably benign 0.06
R4693:Cyp19a1 UTSW 9 54173333 missense possibly damaging 0.55
R4807:Cyp19a1 UTSW 9 54176646 missense possibly damaging 0.89
R4853:Cyp19a1 UTSW 9 54166776 missense probably benign
R4938:Cyp19a1 UTSW 9 54173363 missense probably benign 0.01
R5272:Cyp19a1 UTSW 9 54176614 missense probably benign 0.19
R6148:Cyp19a1 UTSW 9 54180256 missense probably damaging 1.00
R7008:Cyp19a1 UTSW 9 54193325 missense probably benign 0.35
R7472:Cyp19a1 UTSW 9 54166993 missense possibly damaging 0.55
R7807:Cyp19a1 UTSW 9 54166842 missense probably benign 0.06
R7841:Cyp19a1 UTSW 9 54171805 missense probably benign 0.03
R7924:Cyp19a1 UTSW 9 54171805 missense probably benign 0.03
X0025:Cyp19a1 UTSW 9 54168568 missense probably damaging 1.00
Z1176:Cyp19a1 UTSW 9 54176599 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCATTTCGTGGAGGGGAAAAC -3'
(R):5'- AAGAAGTTCACTGTGTTCTCACG -3'

Sequencing Primer
(F):5'- CTAGGGGAAACTTCAGCCTTG -3'
(R):5'- CTCACGGTCTGTTGTAGGTCC -3'
Posted On2015-05-14