Incidental Mutation 'R4158:Arg1'
ID315632
Institutional Source Beutler Lab
Gene Symbol Arg1
Ensembl Gene ENSMUSG00000019987
Gene Namearginase, liver
SynonymsPGIF, AI, Arg-1
MMRRC Submission 041001-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.265) question?
Stock #R4158 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location24915221-24927484 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24922677 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 25 (E25G)
Ref Sequence ENSEMBL: ENSMUSP00000020161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020161]
Predicted Effect probably damaging
Transcript: ENSMUST00000020161
AA Change: E25G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020161
Gene: ENSMUSG00000019987
AA Change: E25G

DomainStartEndE-ValueType
Pfam:Arginase 6 305 1.4e-79 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219852
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220186
Meta Mutation Damage Score 0.1870 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Arginase catalyzes the hydrolysis of arginine to ornithine and urea. At least two isoforms of mammalian arginase exist (types I and II) which differ in their tissue distribution, subcellular localization, immunologic crossreactivity and physiologic function. The type I isoform encoded by this gene, is a cytosolic enzyme and expressed predominantly in the liver as a component of the urea cycle. Inherited deficiency of this enzyme results in argininemia, an autosomal recessive disorder characterized by hyperammonemia. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a null allele show postnatal lethality, hyperammonemia, argininemia, altered plasma levels of other amino acids, enlarged pale livers, and abnormal hepatocytes. Mice homozygous for a different null allele show postnatal lethality, andincreased macrophage nitric oxide production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 43,650,817 H597R probably damaging Het
Adgrf4 G T 17: 42,667,677 H258Q probably benign Het
Ankrd1 T A 19: 36,117,873 K138N probably damaging Het
Arhgef19 T C 4: 141,246,349 I49T possibly damaging Het
Bsn A G 9: 108,112,946 V1869A possibly damaging Het
Cep350 G A 1: 155,932,875 R652W probably damaging Het
Cyp19a1 G A 9: 54,186,696 T94I probably damaging Het
Dnajc13 G A 9: 104,190,442 L1173F probably damaging Het
Dse A G 10: 34,153,334 F587L probably damaging Het
Efcab14 A C 4: 115,740,397 D63A probably damaging Het
Eomes A G 9: 118,478,963 T35A probably benign Het
Fbxl20 T C 11: 98,095,394 probably benign Het
Flcn T C 11: 59,801,121 N234S probably benign Het
Gm20939 A T 17: 94,876,734 Y270F possibly damaging Het
Ikzf4 A T 10: 128,643,736 probably benign Het
Iltifb T C 10: 118,293,132 T151A probably damaging Het
Kcne4 A G 1: 78,818,102 N156D probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lrrc45 A T 11: 120,718,446 D377V possibly damaging Het
Magi3 T C 3: 104,050,961 K603E probably damaging Het
Mocos T C 18: 24,674,246 I345T probably damaging Het
Nox4 A T 7: 87,396,824 H557L possibly damaging Het
Oasl1 A G 5: 114,937,014 K378E possibly damaging Het
Pla2r1 A T 2: 60,422,622 I1375K probably damaging Het
Ppp6r3 T A 19: 3,512,037 H208L probably damaging Het
Ptprz1 A T 6: 23,001,684 K1258* probably null Het
Ptprz1 T C 6: 23,022,205 I844T possibly damaging Het
Sdk1 A G 5: 142,114,399 I1395V probably benign Het
Sec31b T C 19: 44,525,186 N470S probably benign Het
Slc26a7 T C 4: 14,544,197 T369A probably benign Het
Tex14 T G 11: 87,516,769 S900R probably benign Het
Ush2a G A 1: 188,728,710 V2723M probably damaging Het
Vat1l T A 8: 114,371,729 M413K probably benign Het
Zfp981 C A 4: 146,537,623 P335Q probably benign Het
Zfp981 T A 4: 146,537,882 H421Q probably benign Het
Other mutations in Arg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02011:Arg1 APN 10 24916377 missense probably benign 0.00
IGL02889:Arg1 APN 10 24915755 missense probably damaging 0.98
R0180:Arg1 UTSW 10 24916830 missense probably benign
R0256:Arg1 UTSW 10 24916458 missense probably benign 0.00
R0588:Arg1 UTSW 10 24920624 missense probably damaging 1.00
R1014:Arg1 UTSW 10 24916860 missense probably benign
R1327:Arg1 UTSW 10 24920804 splice site probably null
R1965:Arg1 UTSW 10 24916864 synonymous probably null
R2071:Arg1 UTSW 10 24922663 missense probably benign 0.00
R2118:Arg1 UTSW 10 24920723 missense possibly damaging 0.58
R4858:Arg1 UTSW 10 24922638 missense possibly damaging 0.73
R5741:Arg1 UTSW 10 24917999 missense probably benign
R5793:Arg1 UTSW 10 24920642 missense probably benign 0.36
R7453:Arg1 UTSW 10 24915776 missense probably damaging 1.00
R7634:Arg1 UTSW 10 24915729 missense possibly damaging 0.46
R7760:Arg1 UTSW 10 24927463 start gained probably benign
R7803:Arg1 UTSW 10 24916791 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GACCCTGTTTCTTCAGCGTG -3'
(R):5'- TACTTGGTCTGCTATTTGCCAG -3'

Sequencing Primer
(F):5'- GGATCTGTTGGTTTAGCAAATCCCTC -3'
(R):5'- TGGCATAGGTACAATTCACTCC -3'
Posted On2015-05-14