Incidental Mutation 'R4158:Dse'
Institutional Source Beutler Lab
Gene Symbol Dse
Ensembl Gene ENSMUSG00000039497
Gene Namedermatan sulfate epimerase
SynonymsSart2, DS-epi1, B130024B19Rik
MMRRC Submission 041001-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.334) question?
Stock #R4158 (G1)
Quality Score225
Status Validated
Chromosomal Location34151393-34207715 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34153334 bp
Amino Acid Change Phenylalanine to Leucine at position 587 (F587L)
Ref Sequence ENSEMBL: ENSMUSP00000040074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048010] [ENSMUST00000217051]
Predicted Effect probably damaging
Transcript: ENSMUST00000048010
AA Change: F587L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040074
Gene: ENSMUSG00000039497
AA Change: F587L

signal peptide 1 22 N/A INTRINSIC
Pfam:DUF4962 24 353 5.2e-11 PFAM
low complexity region 558 568 N/A INTRINSIC
low complexity region 797 815 N/A INTRINSIC
transmembrane domain 901 923 N/A INTRINSIC
transmembrane domain 935 952 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216774
Predicted Effect probably benign
Transcript: ENSMUST00000217051
Meta Mutation Damage Score 0.5398 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a tumor-rejection antigen. It is localized to the endoplasmic reticulum and functions to convert D-glucuronic acid to L-iduronic acid during the biosynthesis of dermatan sulfate. This antigen possesses tumor epitopes capable of inducing HLA-A24-restricted and tumor-specific cytotoxic T lymphocytes in cancer patients and may be useful for specific immunotherapy. Mutations in this gene cause inmusculocontractural Ehlers-Danlos syndrome. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 9, and a paralogous gene exists on chromosome 18. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and length with altered skin morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 43,650,817 H597R probably damaging Het
Adgrf4 G T 17: 42,667,677 H258Q probably benign Het
Ankrd1 T A 19: 36,117,873 K138N probably damaging Het
Arg1 T C 10: 24,922,677 E25G probably damaging Het
Arhgef19 T C 4: 141,246,349 I49T possibly damaging Het
Bsn A G 9: 108,112,946 V1869A possibly damaging Het
Cep350 G A 1: 155,932,875 R652W probably damaging Het
Cyp19a1 G A 9: 54,186,696 T94I probably damaging Het
Dnajc13 G A 9: 104,190,442 L1173F probably damaging Het
Efcab14 A C 4: 115,740,397 D63A probably damaging Het
Eomes A G 9: 118,478,963 T35A probably benign Het
Fbxl20 T C 11: 98,095,394 probably benign Het
Flcn T C 11: 59,801,121 N234S probably benign Het
Gm20939 A T 17: 94,876,734 Y270F possibly damaging Het
Ikzf4 A T 10: 128,643,736 probably benign Het
Iltifb T C 10: 118,293,132 T151A probably damaging Het
Kcne4 A G 1: 78,818,102 N156D probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lrrc45 A T 11: 120,718,446 D377V possibly damaging Het
Magi3 T C 3: 104,050,961 K603E probably damaging Het
Mocos T C 18: 24,674,246 I345T probably damaging Het
Nox4 A T 7: 87,396,824 H557L possibly damaging Het
Oasl1 A G 5: 114,937,014 K378E possibly damaging Het
Pla2r1 A T 2: 60,422,622 I1375K probably damaging Het
Ppp6r3 T A 19: 3,512,037 H208L probably damaging Het
Ptprz1 A T 6: 23,001,684 K1258* probably null Het
Ptprz1 T C 6: 23,022,205 I844T possibly damaging Het
Sdk1 A G 5: 142,114,399 I1395V probably benign Het
Sec31b T C 19: 44,525,186 N470S probably benign Het
Slc26a7 T C 4: 14,544,197 T369A probably benign Het
Tex14 T G 11: 87,516,769 S900R probably benign Het
Ush2a G A 1: 188,728,710 V2723M probably damaging Het
Vat1l T A 8: 114,371,729 M413K probably benign Het
Zfp981 C A 4: 146,537,623 P335Q probably benign Het
Zfp981 T A 4: 146,537,882 H421Q probably benign Het
Other mutations in Dse
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Dse APN 10 34162805 missense probably damaging 1.00
IGL01828:Dse APN 10 34152776 missense probably damaging 0.97
IGL01835:Dse APN 10 34160217 splice site probably benign
IGL01942:Dse APN 10 34155993 missense probably benign 0.02
IGL02047:Dse APN 10 34162845 nonsense probably null
IGL02208:Dse APN 10 34152437 missense probably benign
IGL02306:Dse APN 10 34160134 missense probably damaging 0.96
IGL02504:Dse APN 10 34152800 missense probably benign
IGL02626:Dse APN 10 34153162 missense probably damaging 0.99
IGL02812:Dse APN 10 34183716 missense probably damaging 1.00
R0018:Dse UTSW 10 34153468 missense probably benign 0.00
R0018:Dse UTSW 10 34153468 missense probably benign 0.00
R0131:Dse UTSW 10 34153664 missense probably damaging 1.00
R1300:Dse UTSW 10 34152415 missense probably benign 0.00
R1502:Dse UTSW 10 34153218 missense probably damaging 1.00
R1619:Dse UTSW 10 34153234 missense probably damaging 1.00
R1736:Dse UTSW 10 34153149 missense probably damaging 1.00
R1857:Dse UTSW 10 34153229 missense probably benign 0.03
R1858:Dse UTSW 10 34153229 missense probably benign 0.03
R1859:Dse UTSW 10 34153229 missense probably benign 0.03
R1868:Dse UTSW 10 34153288 missense possibly damaging 0.86
R1959:Dse UTSW 10 34160206 missense probably damaging 1.00
R2082:Dse UTSW 10 34155940 missense probably damaging 1.00
R2325:Dse UTSW 10 34184047 missense probably benign 0.23
R2883:Dse UTSW 10 34152507 missense probably benign 0.34
R3436:Dse UTSW 10 34152474 missense probably benign
R3818:Dse UTSW 10 34153433 missense probably benign
R4159:Dse UTSW 10 34153334 missense probably damaging 1.00
R4160:Dse UTSW 10 34153334 missense probably damaging 1.00
R4229:Dse UTSW 10 34162744 missense probably damaging 1.00
R4414:Dse UTSW 10 34152636 missense probably benign 0.04
R4667:Dse UTSW 10 34153012 missense probably damaging 1.00
R4669:Dse UTSW 10 34153012 missense probably damaging 1.00
R4777:Dse UTSW 10 34153588 missense possibly damaging 0.56
R5154:Dse UTSW 10 34153661 missense possibly damaging 0.83
R5573:Dse UTSW 10 34152682 missense probably benign 0.02
R5804:Dse UTSW 10 34153379 missense possibly damaging 0.84
R5844:Dse UTSW 10 34153042 missense probably damaging 0.99
R5895:Dse UTSW 10 34152605 missense probably damaging 1.00
R6290:Dse UTSW 10 34152340 missense probably benign 0.00
R6600:Dse UTSW 10 34152541 missense probably benign 0.06
R7088:Dse UTSW 10 34153889 missense probably damaging 1.00
R7254:Dse UTSW 10 34184148 start gained probably benign
R7491:Dse UTSW 10 34152565 missense probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-05-14