Incidental Mutation 'R4158:Iltifb'
ID315634
Institutional Source Beutler Lab
Gene Symbol Iltifb
Ensembl Gene ENSMUSG00000090461
Gene Nameinterleukin 10-related T cell-derived inducible factor beta
SynonymsIL-TIFb
MMRRC Submission 041001-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R4158 (G1)
Quality Score149
Status Validated
Chromosome10
Chromosomal Location118289629-118295038 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118293132 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 151 (T151A)
Ref Sequence ENSEMBL: ENSMUSP00000128415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163808]
Predicted Effect probably damaging
Transcript: ENSMUST00000163808
AA Change: T151A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128415
Gene: ENSMUSG00000090461
AA Change: T151A

DomainStartEndE-ValueType
IL10 49 179 5.21e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179123
Meta Mutation Damage Score 0.1124 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (38/39)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 43,650,817 H597R probably damaging Het
Adgrf4 G T 17: 42,667,677 H258Q probably benign Het
Ankrd1 T A 19: 36,117,873 K138N probably damaging Het
Arg1 T C 10: 24,922,677 E25G probably damaging Het
Arhgef19 T C 4: 141,246,349 I49T possibly damaging Het
Bsn A G 9: 108,112,946 V1869A possibly damaging Het
Cep350 G A 1: 155,932,875 R652W probably damaging Het
Cyp19a1 G A 9: 54,186,696 T94I probably damaging Het
Dnajc13 G A 9: 104,190,442 L1173F probably damaging Het
Dse A G 10: 34,153,334 F587L probably damaging Het
Efcab14 A C 4: 115,740,397 D63A probably damaging Het
Eomes A G 9: 118,478,963 T35A probably benign Het
Fbxl20 T C 11: 98,095,394 probably benign Het
Flcn T C 11: 59,801,121 N234S probably benign Het
Gm20939 A T 17: 94,876,734 Y270F possibly damaging Het
Ikzf4 A T 10: 128,643,736 probably benign Het
Kcne4 A G 1: 78,818,102 N156D probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lrrc45 A T 11: 120,718,446 D377V possibly damaging Het
Magi3 T C 3: 104,050,961 K603E probably damaging Het
Mocos T C 18: 24,674,246 I345T probably damaging Het
Nox4 A T 7: 87,396,824 H557L possibly damaging Het
Oasl1 A G 5: 114,937,014 K378E possibly damaging Het
Pla2r1 A T 2: 60,422,622 I1375K probably damaging Het
Ppp6r3 T A 19: 3,512,037 H208L probably damaging Het
Ptprz1 A T 6: 23,001,684 K1258* probably null Het
Ptprz1 T C 6: 23,022,205 I844T possibly damaging Het
Sdk1 A G 5: 142,114,399 I1395V probably benign Het
Sec31b T C 19: 44,525,186 N470S probably benign Het
Slc26a7 T C 4: 14,544,197 T369A probably benign Het
Tex14 T G 11: 87,516,769 S900R probably benign Het
Ush2a G A 1: 188,728,710 V2723M probably damaging Het
Vat1l T A 8: 114,371,729 M413K probably benign Het
Zfp981 C A 4: 146,537,623 P335Q probably benign Het
Zfp981 T A 4: 146,537,882 H421Q probably benign Het
Other mutations in Iltifb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01796:Iltifb APN 10 118290164 missense possibly damaging 0.70
IGL02149:Iltifb APN 10 118294997 utr 5 prime probably benign
IGL02965:Iltifb APN 10 118294857 missense probably damaging 0.98
R0310:Iltifb UTSW 10 118293185 missense probably benign 0.41
R0730:Iltifb UTSW 10 118294237 missense probably benign 0.01
R1078:Iltifb UTSW 10 118290151 makesense probably null
R4067:Iltifb UTSW 10 118290210 missense probably damaging 0.99
R4911:Iltifb UTSW 10 118294989 start codon destroyed probably null 0.99
R5433:Iltifb UTSW 10 118294884 missense probably damaging 0.96
R5778:Iltifb UTSW 10 118294863 nonsense probably null
R7295:Iltifb UTSW 10 118294943 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCTAGCTCCAGAATTGTGAC -3'
(R):5'- AAATCTAGGTCACAGCGGGC -3'

Sequencing Primer
(F):5'- AGATTGAAAGATCTATAGACCCAGC -3'
(R):5'- GGGCAAAAATGACTGAACGCCTC -3'
Posted On2015-05-14