Incidental Mutation 'R4158:Ikzf4'
Institutional Source Beutler Lab
Gene Symbol Ikzf4
Ensembl Gene ENSMUSG00000002578
Gene NameIKAROS family zinc finger 4
SynonymsEos, Zfpn1a4, A630026H08Rik
MMRRC Submission 041001-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4158 (G1)
Quality Score225
Status Validated
Chromosomal Location128630843-128645991 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 128643736 bp
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000133342] [ENSMUST00000221150] [ENSMUST00000222067] [ENSMUST00000223162]
Predicted Effect unknown
Transcript: ENSMUST00000105233
AA Change: C71S
Predicted Effect probably benign
Transcript: ENSMUST00000133342
SMART Domains Protein: ENSMUSP00000114404
Gene: ENSMUSG00000002578

ZnF_C2H2 159 181 7.67e-2 SMART
ZnF_C2H2 187 209 1.72e-4 SMART
ZnF_C2H2 215 237 1.72e-4 SMART
ZnF_C2H2 248 271 1.18e-2 SMART
low complexity region 423 436 N/A INTRINSIC
low complexity region 475 484 N/A INTRINSIC
ZnF_C2H2 531 553 7.49e0 SMART
ZnF_C2H2 559 583 3.52e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149762
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221022
Predicted Effect probably benign
Transcript: ENSMUST00000221150
Predicted Effect probably benign
Transcript: ENSMUST00000222067
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222899
Predicted Effect probably benign
Transcript: ENSMUST00000222901
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223145
Predicted Effect unknown
Transcript: ENSMUST00000223162
AA Change: C71S
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the Ikaros (ZNFN1A1; MIM 603023) family of transcription factors, which includes Eos, are expressed in lymphocytes and are implicated in the control of lymphoid development.[supplied by OMIM, Jul 2002]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 43,650,817 H597R probably damaging Het
Adgrf4 G T 17: 42,667,677 H258Q probably benign Het
Ankrd1 T A 19: 36,117,873 K138N probably damaging Het
Arg1 T C 10: 24,922,677 E25G probably damaging Het
Arhgef19 T C 4: 141,246,349 I49T possibly damaging Het
Bsn A G 9: 108,112,946 V1869A possibly damaging Het
Cep350 G A 1: 155,932,875 R652W probably damaging Het
Cyp19a1 G A 9: 54,186,696 T94I probably damaging Het
Dnajc13 G A 9: 104,190,442 L1173F probably damaging Het
Dse A G 10: 34,153,334 F587L probably damaging Het
Efcab14 A C 4: 115,740,397 D63A probably damaging Het
Eomes A G 9: 118,478,963 T35A probably benign Het
Fbxl20 T C 11: 98,095,394 probably benign Het
Flcn T C 11: 59,801,121 N234S probably benign Het
Gm20939 A T 17: 94,876,734 Y270F possibly damaging Het
Iltifb T C 10: 118,293,132 T151A probably damaging Het
Kcne4 A G 1: 78,818,102 N156D probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lrrc45 A T 11: 120,718,446 D377V possibly damaging Het
Magi3 T C 3: 104,050,961 K603E probably damaging Het
Mocos T C 18: 24,674,246 I345T probably damaging Het
Nox4 A T 7: 87,396,824 H557L possibly damaging Het
Oasl1 A G 5: 114,937,014 K378E possibly damaging Het
Pla2r1 A T 2: 60,422,622 I1375K probably damaging Het
Ppp6r3 T A 19: 3,512,037 H208L probably damaging Het
Ptprz1 A T 6: 23,001,684 K1258* probably null Het
Ptprz1 T C 6: 23,022,205 I844T possibly damaging Het
Sdk1 A G 5: 142,114,399 I1395V probably benign Het
Sec31b T C 19: 44,525,186 N470S probably benign Het
Slc26a7 T C 4: 14,544,197 T369A probably benign Het
Tex14 T G 11: 87,516,769 S900R probably benign Het
Ush2a G A 1: 188,728,710 V2723M probably damaging Het
Vat1l T A 8: 114,371,729 M413K probably benign Het
Zfp981 C A 4: 146,537,623 P335Q probably benign Het
Zfp981 T A 4: 146,537,882 H421Q probably benign Het
Other mutations in Ikzf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Ikzf4 APN 10 128634547 missense probably benign 0.00
IGL01649:Ikzf4 APN 10 128635820 missense probably damaging 1.00
IGL02261:Ikzf4 APN 10 128636722 missense possibly damaging 0.50
IGL02315:Ikzf4 APN 10 128634145 missense probably damaging 1.00
R0099:Ikzf4 UTSW 10 128634197 missense probably damaging 0.97
R0200:Ikzf4 UTSW 10 128634676 missense probably damaging 0.96
R0365:Ikzf4 UTSW 10 128634407 missense probably benign
R0376:Ikzf4 UTSW 10 128632756 missense probably benign
R0456:Ikzf4 UTSW 10 128635808 missense probably damaging 0.98
R0536:Ikzf4 UTSW 10 128641249 missense probably benign 0.09
R1731:Ikzf4 UTSW 10 128634532 missense probably benign 0.03
R2017:Ikzf4 UTSW 10 128634157 missense probably damaging 1.00
R4160:Ikzf4 UTSW 10 128643736 intron probably benign
R4623:Ikzf4 UTSW 10 128641119 missense probably damaging 1.00
R4789:Ikzf4 UTSW 10 128632706 missense probably benign 0.00
R5008:Ikzf4 UTSW 10 128641250 missense probably benign 0.03
R5432:Ikzf4 UTSW 10 128634178 missense probably damaging 1.00
R6091:Ikzf4 UTSW 10 128634673 missense probably benign 0.15
R6445:Ikzf4 UTSW 10 128636555 intron probably null
R7204:Ikzf4 UTSW 10 128643890 missense possibly damaging 0.64
R7219:Ikzf4 UTSW 10 128634383 missense possibly damaging 0.64
R7239:Ikzf4 UTSW 10 128641244 missense probably damaging 1.00
R7485:Ikzf4 UTSW 10 128632582 missense unknown
R7710:Ikzf4 UTSW 10 128632741 missense possibly damaging 0.46
Z1176:Ikzf4 UTSW 10 128634230 missense possibly damaging 0.69
Z1177:Ikzf4 UTSW 10 128642640 missense possibly damaging 0.94
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-05-14