Incidental Mutation 'R4158:Tex14'
ID315637
Institutional Source Beutler Lab
Gene Symbol Tex14
Ensembl Gene ENSMUSG00000010342
Gene Nametestis expressed gene 14
Synonyms
MMRRC Submission 041001-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.199) question?
Stock #R4158 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location87405065-87555823 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 87516769 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 900 (S900R)
Ref Sequence ENSEMBL: ENSMUSP00000054444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060835]
Predicted Effect probably benign
Transcript: ENSMUST00000060835
AA Change: S900R

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000054444
Gene: ENSMUSG00000010342
AA Change: S900R

DomainStartEndE-ValueType
ANK 22 51 7.99e2 SMART
ANK 55 84 6.36e-3 SMART
ANK 88 117 3.49e0 SMART
Pfam:Pkinase 251 504 3.5e-19 PFAM
Pfam:Pkinase_Tyr 254 503 8.1e-28 PFAM
coiled coil region 659 684 N/A INTRINSIC
coiled coil region 740 776 N/A INTRINSIC
low complexity region 1219 1236 N/A INTRINSIC
coiled coil region 1289 1309 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is necessary for intercellular bridges in germ cells, which are required for spermatogenesis. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2011]
PHENOTYPE: Males homozygous for a targeted allele are infertile due to spermatogenic failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 43,650,817 H597R probably damaging Het
Adgrf4 G T 17: 42,667,677 H258Q probably benign Het
Ankrd1 T A 19: 36,117,873 K138N probably damaging Het
Arg1 T C 10: 24,922,677 E25G probably damaging Het
Arhgef19 T C 4: 141,246,349 I49T possibly damaging Het
Bsn A G 9: 108,112,946 V1869A possibly damaging Het
Cep350 G A 1: 155,932,875 R652W probably damaging Het
Cyp19a1 G A 9: 54,186,696 T94I probably damaging Het
Dnajc13 G A 9: 104,190,442 L1173F probably damaging Het
Dse A G 10: 34,153,334 F587L probably damaging Het
Efcab14 A C 4: 115,740,397 D63A probably damaging Het
Eomes A G 9: 118,478,963 T35A probably benign Het
Fbxl20 T C 11: 98,095,394 probably benign Het
Flcn T C 11: 59,801,121 N234S probably benign Het
Gm20939 A T 17: 94,876,734 Y270F possibly damaging Het
Ikzf4 A T 10: 128,643,736 probably benign Het
Iltifb T C 10: 118,293,132 T151A probably damaging Het
Kcne4 A G 1: 78,818,102 N156D probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lrrc45 A T 11: 120,718,446 D377V possibly damaging Het
Magi3 T C 3: 104,050,961 K603E probably damaging Het
Mocos T C 18: 24,674,246 I345T probably damaging Het
Nox4 A T 7: 87,396,824 H557L possibly damaging Het
Oasl1 A G 5: 114,937,014 K378E possibly damaging Het
Pla2r1 A T 2: 60,422,622 I1375K probably damaging Het
Ppp6r3 T A 19: 3,512,037 H208L probably damaging Het
Ptprz1 A T 6: 23,001,684 K1258* probably null Het
Ptprz1 T C 6: 23,022,205 I844T possibly damaging Het
Sdk1 A G 5: 142,114,399 I1395V probably benign Het
Sec31b T C 19: 44,525,186 N470S probably benign Het
Slc26a7 T C 4: 14,544,197 T369A probably benign Het
Ush2a G A 1: 188,728,710 V2723M probably damaging Het
Vat1l T A 8: 114,371,729 M413K probably benign Het
Zfp981 C A 4: 146,537,623 P335Q probably benign Het
Zfp981 T A 4: 146,537,882 H421Q probably benign Het
Other mutations in Tex14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Tex14 APN 11 87535643 missense probably damaging 0.98
IGL00494:Tex14 APN 11 87555484 missense probably damaging 1.00
IGL01604:Tex14 APN 11 87509698 missense possibly damaging 0.63
IGL02690:Tex14 APN 11 87486274 missense probably benign 0.11
IGL02888:Tex14 APN 11 87527912 critical splice donor site probably null
IGL03073:Tex14 APN 11 87535609 missense probably damaging 0.99
IGL03109:Tex14 APN 11 87543365 missense probably damaging 1.00
IGL03047:Tex14 UTSW 11 87536704 missense probably damaging 1.00
R0141:Tex14 UTSW 11 87493031 splice site probably null
R0455:Tex14 UTSW 11 87514305 missense possibly damaging 0.93
R0624:Tex14 UTSW 11 87520699 missense probably benign 0.19
R0718:Tex14 UTSW 11 87499613 missense probably benign 0.20
R1077:Tex14 UTSW 11 87519745 splice site probably benign
R1118:Tex14 UTSW 11 87522517 missense probably benign 0.07
R1120:Tex14 UTSW 11 87538676 splice site probably benign
R1168:Tex14 UTSW 11 87536742 missense probably benign 0.11
R1190:Tex14 UTSW 11 87495108 intron probably null
R1470:Tex14 UTSW 11 87549529 splice site probably benign
R1563:Tex14 UTSW 11 87536808 missense probably damaging 0.99
R1607:Tex14 UTSW 11 87554928 missense probably damaging 1.00
R1696:Tex14 UTSW 11 87511545 missense possibly damaging 0.49
R1873:Tex14 UTSW 11 87499605 missense probably damaging 1.00
R1894:Tex14 UTSW 11 87474448 missense probably damaging 1.00
R1911:Tex14 UTSW 11 87495035 missense probably damaging 1.00
R1955:Tex14 UTSW 11 87509621 missense probably damaging 1.00
R1971:Tex14 UTSW 11 87511605 missense probably damaging 1.00
R1990:Tex14 UTSW 11 87549470 missense probably damaging 1.00
R1991:Tex14 UTSW 11 87549470 missense probably damaging 1.00
R1993:Tex14 UTSW 11 87536755 missense possibly damaging 0.57
R2106:Tex14 UTSW 11 87486250 missense possibly damaging 0.47
R2118:Tex14 UTSW 11 87519743 splice site probably benign
R2860:Tex14 UTSW 11 87474417 missense probably damaging 1.00
R2861:Tex14 UTSW 11 87474417 missense probably damaging 1.00
R4016:Tex14 UTSW 11 87538623 unclassified probably null
R4089:Tex14 UTSW 11 87512203 missense probably damaging 1.00
R4533:Tex14 UTSW 11 87536829 nonsense probably null
R4713:Tex14 UTSW 11 87536865 missense probably damaging 0.99
R4758:Tex14 UTSW 11 87514485 missense probably benign 0.00
R4880:Tex14 UTSW 11 87486295 missense possibly damaging 0.95
R4953:Tex14 UTSW 11 87536901 critical splice donor site probably null
R5092:Tex14 UTSW 11 87514842 missense probably benign 0.03
R5119:Tex14 UTSW 11 87433813 missense probably damaging 1.00
R5322:Tex14 UTSW 11 87511472 missense probably benign 0.04
R5470:Tex14 UTSW 11 87551604 missense probably damaging 0.99
R5607:Tex14 UTSW 11 87522578 missense probably benign 0.00
R5642:Tex14 UTSW 11 87514220 missense probably benign
R5643:Tex14 UTSW 11 87535626 missense probably damaging 1.00
R5786:Tex14 UTSW 11 87514295 missense probably damaging 0.97
R6478:Tex14 UTSW 11 87514373 missense probably benign
R6560:Tex14 UTSW 11 87497862 missense possibly damaging 0.95
R6661:Tex14 UTSW 11 87495016 missense probably damaging 1.00
R7037:Tex14 UTSW 11 87497915 missense probably damaging 1.00
R7156:Tex14 UTSW 11 87484719 missense probably damaging 0.99
R7465:Tex14 UTSW 11 87514430 missense possibly damaging 0.48
R7675:Tex14 UTSW 11 87509678 missense probably damaging 1.00
R7725:Tex14 UTSW 11 87495042 missense probably damaging 0.99
R7911:Tex14 UTSW 11 87533602 critical splice donor site probably null
R7992:Tex14 UTSW 11 87533602 critical splice donor site probably null
R8015:Tex14 UTSW 11 87509600 missense probably benign 0.13
RF018:Tex14 UTSW 11 87514746 missense probably benign 0.01
X0017:Tex14 UTSW 11 87535549 nonsense probably null
Z1176:Tex14 UTSW 11 87484807 missense probably benign 0.08
Z1176:Tex14 UTSW 11 87499593 missense possibly damaging 0.95
Z1177:Tex14 UTSW 11 87514155 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGGCTGAGTACTTAGACTCCAC -3'
(R):5'- AAGCTGTCATCCATTTGGCTTG -3'

Sequencing Primer
(F):5'- CTGAGTACTTAGACTCCACATTTTTG -3'
(R):5'- GTGATGTCTCCTGCAGGTTTCC -3'
Posted On2015-05-14