Incidental Mutation 'R4158:Fbxl20'
ID315638
Institutional Source Beutler Lab
Gene Symbol Fbxl20
Ensembl Gene ENSMUSG00000020883
Gene NameF-box and leucine-rich repeat protein 20
Synonyms2610511F20Rik, C86145, 4632423N09Rik, Fbl2, Scrapper, Scr
MMRRC Submission 041001-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R4158 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location98082556-98150403 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 98095394 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103143] [ENSMUST00000147971] [ENSMUST00000150378]
Predicted Effect probably benign
Transcript: ENSMUST00000103143
SMART Domains Protein: ENSMUSP00000099432
Gene: ENSMUSG00000020883

DomainStartEndE-ValueType
FBOX 28 68 2.62e-8 SMART
LRR 90 115 2.02e-1 SMART
LRR 116 141 1.77e1 SMART
LRR 142 167 7.9e-4 SMART
LRR_CC 168 193 4.61e-5 SMART
LRR 194 219 7.15e-2 SMART
LRR 220 245 1.67e-2 SMART
LRR 246 271 1.2e-3 SMART
LRR 272 297 2.61e-4 SMART
LRR 298 323 1.26e-2 SMART
LRR_CC 324 349 1.77e-6 SMART
LRR 353 377 6.06e2 SMART
LRR 378 403 2.14e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135969
Predicted Effect unknown
Transcript: ENSMUST00000147971
AA Change: T133A
SMART Domains Protein: ENSMUSP00000123507
Gene: ENSMUSG00000020883
AA Change: T133A

DomainStartEndE-ValueType
LRR 14 39 7.15e-2 SMART
LRR 40 65 1.67e-2 SMART
LRR 66 91 1.2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150378
SMART Domains Protein: ENSMUSP00000119003
Gene: ENSMUSG00000020883

DomainStartEndE-ValueType
FBOX 30 70 2.62e-8 SMART
LRR 92 117 3.69e1 SMART
LRR 121 146 7.9e-4 SMART
LRR_CC 147 172 4.61e-5 SMART
LRR 173 198 7.15e-2 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXL20, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some embryonic lethality, shortened lifespans, decreased body size and altered CNS synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 43,650,817 H597R probably damaging Het
Adgrf4 G T 17: 42,667,677 H258Q probably benign Het
Ankrd1 T A 19: 36,117,873 K138N probably damaging Het
Arg1 T C 10: 24,922,677 E25G probably damaging Het
Arhgef19 T C 4: 141,246,349 I49T possibly damaging Het
Bsn A G 9: 108,112,946 V1869A possibly damaging Het
Cep350 G A 1: 155,932,875 R652W probably damaging Het
Cyp19a1 G A 9: 54,186,696 T94I probably damaging Het
Dnajc13 G A 9: 104,190,442 L1173F probably damaging Het
Dse A G 10: 34,153,334 F587L probably damaging Het
Efcab14 A C 4: 115,740,397 D63A probably damaging Het
Eomes A G 9: 118,478,963 T35A probably benign Het
Flcn T C 11: 59,801,121 N234S probably benign Het
Gm20939 A T 17: 94,876,734 Y270F possibly damaging Het
Ikzf4 A T 10: 128,643,736 probably benign Het
Iltifb T C 10: 118,293,132 T151A probably damaging Het
Kcne4 A G 1: 78,818,102 N156D probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lrrc45 A T 11: 120,718,446 D377V possibly damaging Het
Magi3 T C 3: 104,050,961 K603E probably damaging Het
Mocos T C 18: 24,674,246 I345T probably damaging Het
Nox4 A T 7: 87,396,824 H557L possibly damaging Het
Oasl1 A G 5: 114,937,014 K378E possibly damaging Het
Pla2r1 A T 2: 60,422,622 I1375K probably damaging Het
Ppp6r3 T A 19: 3,512,037 H208L probably damaging Het
Ptprz1 A T 6: 23,001,684 K1258* probably null Het
Ptprz1 T C 6: 23,022,205 I844T possibly damaging Het
Sdk1 A G 5: 142,114,399 I1395V probably benign Het
Sec31b T C 19: 44,525,186 N470S probably benign Het
Slc26a7 T C 4: 14,544,197 T369A probably benign Het
Tex14 T G 11: 87,516,769 S900R probably benign Het
Ush2a G A 1: 188,728,710 V2723M probably damaging Het
Vat1l T A 8: 114,371,729 M413K probably benign Het
Zfp981 C A 4: 146,537,623 P335Q probably benign Het
Zfp981 T A 4: 146,537,882 H421Q probably benign Het
Other mutations in Fbxl20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Fbxl20 APN 11 98090674 missense possibly damaging 0.70
IGL00161:Fbxl20 APN 11 98090674 missense possibly damaging 0.70
IGL00590:Fbxl20 APN 11 98093129 missense probably damaging 1.00
IGL00944:Fbxl20 APN 11 98113242 missense probably damaging 1.00
IGL00966:Fbxl20 APN 11 98110974 missense probably damaging 1.00
IGL01344:Fbxl20 APN 11 98100100 nonsense probably null
IGL02394:Fbxl20 APN 11 98113256 missense probably damaging 1.00
R0270:Fbxl20 UTSW 11 98098503 splice site probably benign
R1564:Fbxl20 UTSW 11 98098486 missense probably damaging 1.00
R2227:Fbxl20 UTSW 11 98090849 missense probably benign 0.12
R3902:Fbxl20 UTSW 11 98097035 missense probably benign 0.03
R4516:Fbxl20 UTSW 11 98095235 unclassified probably benign
R4916:Fbxl20 UTSW 11 98128360 missense probably damaging 1.00
R5905:Fbxl20 UTSW 11 98115445 missense probably damaging 1.00
R6791:Fbxl20 UTSW 11 98109510 missense probably benign 0.05
R6916:Fbxl20 UTSW 11 98113253 missense possibly damaging 0.78
R7381:Fbxl20 UTSW 11 98090788 missense probably benign 0.01
R7536:Fbxl20 UTSW 11 98095383 nonsense probably null
X0067:Fbxl20 UTSW 11 98096978 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- AGTTAGGCTCCTGGTTCCTG -3'
(R):5'- GTACTCCAGCAGTCCTCTTG -3'

Sequencing Primer
(F):5'- GTGACTACACAAGTTTGTGC -3'
(R):5'- CAAGTGAAATCTGCTGCGACCTG -3'
Posted On2015-05-14