Incidental Mutation 'R4158:Adgrf4'
ID315640
Institutional Source Beutler Lab
Gene Symbol Adgrf4
Ensembl Gene ENSMUSG00000023918
Gene Nameadhesion G protein-coupled receptor F4
Synonyms4632435A09Rik, Gpr115
MMRRC Submission 041001-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4158 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location42656891-42692284 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 42667677 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 258 (H258Q)
Ref Sequence ENSEMBL: ENSMUSP00000133261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024711] [ENSMUST00000164524] [ENSMUST00000167993] [ENSMUST00000170723]
Predicted Effect probably benign
Transcript: ENSMUST00000024711
AA Change: H258Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024711
Gene: ENSMUSG00000023918
AA Change: H258Q

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
low complexity region 103 112 N/A INTRINSIC
low complexity region 252 263 N/A INTRINSIC
GPS 349 400 1.25e-8 SMART
Pfam:7tm_2 402 653 5.9e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164524
SMART Domains Protein: ENSMUSP00000129114
Gene: ENSMUSG00000023918

DomainStartEndE-ValueType
SCOP:g1qd6.1 20 44 1e-2 SMART
low complexity region 54 64 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167993
AA Change: H258Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132890
Gene: ENSMUSG00000023918
AA Change: H258Q

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
low complexity region 103 112 N/A INTRINSIC
low complexity region 252 263 N/A INTRINSIC
GPS 349 400 1.25e-8 SMART
Pfam:7tm_2 402 653 5.9e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170723
AA Change: H258Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133261
Gene: ENSMUSG00000023918
AA Change: H258Q

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
low complexity region 103 112 N/A INTRINSIC
low complexity region 252 263 N/A INTRINSIC
GPS 349 400 1.25e-8 SMART
Pfam:7tm_2 402 653 9.2e-36 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sequence analysis of this gene suggests that it is encodes a member of the superfamily of G protein-couple receptors. G protein-coupled receptors typically contain seven hydrophobic transmembrane domains, interact with guanine nucleotide binding regulatory proteins, and detect molecules outside the cell and act to transduce these signals into intracellular responses. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a reporter allele exhibit normal viability and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 43,650,817 H597R probably damaging Het
Ankrd1 T A 19: 36,117,873 K138N probably damaging Het
Arg1 T C 10: 24,922,677 E25G probably damaging Het
Arhgef19 T C 4: 141,246,349 I49T possibly damaging Het
Bsn A G 9: 108,112,946 V1869A possibly damaging Het
Cep350 G A 1: 155,932,875 R652W probably damaging Het
Cyp19a1 G A 9: 54,186,696 T94I probably damaging Het
Dnajc13 G A 9: 104,190,442 L1173F probably damaging Het
Dse A G 10: 34,153,334 F587L probably damaging Het
Efcab14 A C 4: 115,740,397 D63A probably damaging Het
Eomes A G 9: 118,478,963 T35A probably benign Het
Fbxl20 T C 11: 98,095,394 probably benign Het
Flcn T C 11: 59,801,121 N234S probably benign Het
Gm20939 A T 17: 94,876,734 Y270F possibly damaging Het
Ikzf4 A T 10: 128,643,736 probably benign Het
Iltifb T C 10: 118,293,132 T151A probably damaging Het
Kcne4 A G 1: 78,818,102 N156D probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lrrc45 A T 11: 120,718,446 D377V possibly damaging Het
Magi3 T C 3: 104,050,961 K603E probably damaging Het
Mocos T C 18: 24,674,246 I345T probably damaging Het
Nox4 A T 7: 87,396,824 H557L possibly damaging Het
Oasl1 A G 5: 114,937,014 K378E possibly damaging Het
Pla2r1 A T 2: 60,422,622 I1375K probably damaging Het
Ppp6r3 T A 19: 3,512,037 H208L probably damaging Het
Ptprz1 A T 6: 23,001,684 K1258* probably null Het
Ptprz1 T C 6: 23,022,205 I844T possibly damaging Het
Sdk1 A G 5: 142,114,399 I1395V probably benign Het
Sec31b T C 19: 44,525,186 N470S probably benign Het
Slc26a7 T C 4: 14,544,197 T369A probably benign Het
Tex14 T G 11: 87,516,769 S900R probably benign Het
Ush2a G A 1: 188,728,710 V2723M probably damaging Het
Vat1l T A 8: 114,371,729 M413K probably benign Het
Zfp981 C A 4: 146,537,623 P335Q probably benign Het
Zfp981 T A 4: 146,537,882 H421Q probably benign Het
Other mutations in Adgrf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Adgrf4 APN 17 42666656 missense probably damaging 1.00
IGL00474:Adgrf4 APN 17 42675759 missense probably damaging 0.97
IGL00913:Adgrf4 APN 17 42666902 missense possibly damaging 0.81
IGL02134:Adgrf4 APN 17 42669690 missense probably damaging 1.00
IGL02225:Adgrf4 APN 17 42663378 critical splice donor site probably null
IGL02423:Adgrf4 APN 17 42672576 missense probably benign 0.06
IGL02945:Adgrf4 APN 17 42667366 missense probably benign
R0329:Adgrf4 UTSW 17 42667313 missense probably damaging 1.00
R0330:Adgrf4 UTSW 17 42667313 missense probably damaging 1.00
R1595:Adgrf4 UTSW 17 42667873 missense probably benign 0.09
R1739:Adgrf4 UTSW 17 42666898 missense possibly damaging 0.93
R1762:Adgrf4 UTSW 17 42666898 missense possibly damaging 0.93
R1783:Adgrf4 UTSW 17 42666898 missense possibly damaging 0.93
R1785:Adgrf4 UTSW 17 42666898 missense possibly damaging 0.93
R2038:Adgrf4 UTSW 17 42667863 missense probably damaging 1.00
R2069:Adgrf4 UTSW 17 42666898 missense possibly damaging 0.93
R2140:Adgrf4 UTSW 17 42666898 missense possibly damaging 0.93
R2142:Adgrf4 UTSW 17 42666898 missense possibly damaging 0.93
R2230:Adgrf4 UTSW 17 42666898 missense possibly damaging 0.93
R2232:Adgrf4 UTSW 17 42666898 missense possibly damaging 0.93
R2288:Adgrf4 UTSW 17 42667511 missense probably benign
R3107:Adgrf4 UTSW 17 42666867 nonsense probably null
R3732:Adgrf4 UTSW 17 42672581 missense probably damaging 1.00
R4003:Adgrf4 UTSW 17 42669759 missense probably damaging 1.00
R4160:Adgrf4 UTSW 17 42667677 missense probably benign
R4163:Adgrf4 UTSW 17 42667586 missense probably benign
R4865:Adgrf4 UTSW 17 42667265 missense probably damaging 1.00
R4940:Adgrf4 UTSW 17 42666529 missense possibly damaging 0.90
R5411:Adgrf4 UTSW 17 42667213 missense probably damaging 1.00
R5512:Adgrf4 UTSW 17 42667285 missense probably benign 0.03
R6421:Adgrf4 UTSW 17 42672501 missense probably damaging 1.00
R7089:Adgrf4 UTSW 17 42666533 missense possibly damaging 0.95
R7261:Adgrf4 UTSW 17 42667435 missense probably benign 0.01
R7359:Adgrf4 UTSW 17 42667112 missense possibly damaging 0.78
R7502:Adgrf4 UTSW 17 42669657 missense possibly damaging 0.53
R7522:Adgrf4 UTSW 17 42669784 missense probably benign 0.04
R7555:Adgrf4 UTSW 17 42672603 missense probably benign 0.16
R7567:Adgrf4 UTSW 17 42667442 missense probably benign
R7743:Adgrf4 UTSW 17 42672562 nonsense probably null
R8002:Adgrf4 UTSW 17 42667792 missense probably benign 0.05
X0027:Adgrf4 UTSW 17 42667528 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTCAGACCTTCTGGCAAAACC -3'
(R):5'- ACTGCCATTTCAAATTGGGCTTTC -3'

Sequencing Primer
(F):5'- AGGTCATCTATAGGCTTTTGGAG -3'
(R):5'- GCTTTCATTGCCAACAAAAATGC -3'
Posted On2015-05-14