Incidental Mutation 'R4158:Ppp6r3'
ID315643
Institutional Source Beutler Lab
Gene Symbol Ppp6r3
Ensembl Gene ENSMUSG00000024908
Gene Nameprotein phosphatase 6, regulatory subunit 3
SynonymsPp6r3, D19Ertd703e, D19Bwg1430e, 4930528G08Rik, Saps3, 9130026N02Rik, Pptcs3
MMRRC Submission 041001-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.855) question?
Stock #R4158 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location3454928-3575749 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3512037 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 208 (H208L)
Ref Sequence ENSEMBL: ENSMUSP00000131084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025846] [ENSMUST00000113997] [ENSMUST00000172362]
Predicted Effect probably damaging
Transcript: ENSMUST00000025846
AA Change: H208L

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025846
Gene: ENSMUSG00000024908
AA Change: H208L

DomainStartEndE-ValueType
coiled coil region 25 52 N/A INTRINSIC
Pfam:SAPS 128 365 2.7e-69 PFAM
Pfam:SAPS 360 513 1.4e-44 PFAM
low complexity region 609 627 N/A INTRINSIC
low complexity region 743 758 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113997
AA Change: H208L

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109630
Gene: ENSMUSG00000024908
AA Change: H208L

DomainStartEndE-ValueType
coiled coil region 25 52 N/A INTRINSIC
Pfam:SAPS 128 365 5.8e-69 PFAM
Pfam:SAPS 363 513 2.7e-44 PFAM
low complexity region 638 656 N/A INTRINSIC
low complexity region 772 787 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172362
AA Change: H208L

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131084
Gene: ENSMUSG00000024908
AA Change: H208L

DomainStartEndE-ValueType
coiled coil region 25 52 N/A INTRINSIC
Pfam:SAPS 128 365 2.6e-69 PFAM
Pfam:SAPS 360 513 1.3e-44 PFAM
low complexity region 592 610 N/A INTRINSIC
low complexity region 726 741 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223919
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225446
Meta Mutation Damage Score 0.8613 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein phosphatase regulatory subunits, such as SAPS3, modulate the activity of protein phosphatase catalytic subunits by restricting substrate specificity, recruiting substrates, and determining the intracellular localization of the holoenzyme. SAPS3 is a regulatory subunit for the protein phosphatase-6 catalytic subunit (PPP6C; MIM 612725) (Stefansson and Brautigan, 2006 [PubMed 16769727]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 43,650,817 H597R probably damaging Het
Adgrf4 G T 17: 42,667,677 H258Q probably benign Het
Ankrd1 T A 19: 36,117,873 K138N probably damaging Het
Arg1 T C 10: 24,922,677 E25G probably damaging Het
Arhgef19 T C 4: 141,246,349 I49T possibly damaging Het
Bsn A G 9: 108,112,946 V1869A possibly damaging Het
Cep350 G A 1: 155,932,875 R652W probably damaging Het
Cyp19a1 G A 9: 54,186,696 T94I probably damaging Het
Dnajc13 G A 9: 104,190,442 L1173F probably damaging Het
Dse A G 10: 34,153,334 F587L probably damaging Het
Efcab14 A C 4: 115,740,397 D63A probably damaging Het
Eomes A G 9: 118,478,963 T35A probably benign Het
Fbxl20 T C 11: 98,095,394 probably benign Het
Flcn T C 11: 59,801,121 N234S probably benign Het
Gm20939 A T 17: 94,876,734 Y270F possibly damaging Het
Ikzf4 A T 10: 128,643,736 probably benign Het
Iltifb T C 10: 118,293,132 T151A probably damaging Het
Kcne4 A G 1: 78,818,102 N156D probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lrrc45 A T 11: 120,718,446 D377V possibly damaging Het
Magi3 T C 3: 104,050,961 K603E probably damaging Het
Mocos T C 18: 24,674,246 I345T probably damaging Het
Nox4 A T 7: 87,396,824 H557L possibly damaging Het
Oasl1 A G 5: 114,937,014 K378E possibly damaging Het
Pla2r1 A T 2: 60,422,622 I1375K probably damaging Het
Ptprz1 A T 6: 23,001,684 K1258* probably null Het
Ptprz1 T C 6: 23,022,205 I844T possibly damaging Het
Sdk1 A G 5: 142,114,399 I1395V probably benign Het
Sec31b T C 19: 44,525,186 N470S probably benign Het
Slc26a7 T C 4: 14,544,197 T369A probably benign Het
Tex14 T G 11: 87,516,769 S900R probably benign Het
Ush2a G A 1: 188,728,710 V2723M probably damaging Het
Vat1l T A 8: 114,371,729 M413K probably benign Het
Zfp981 C A 4: 146,537,623 P335Q probably benign Het
Zfp981 T A 4: 146,537,882 H421Q probably benign Het
Other mutations in Ppp6r3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Ppp6r3 APN 19 3514729 splice site probably null
IGL00340:Ppp6r3 APN 19 3518324 missense probably damaging 1.00
IGL00585:Ppp6r3 APN 19 3490826 missense probably damaging 0.99
IGL01304:Ppp6r3 APN 19 3467261 missense probably damaging 0.99
IGL02048:Ppp6r3 APN 19 3473848 missense possibly damaging 0.96
IGL02055:Ppp6r3 APN 19 3521781 missense probably benign 0.01
IGL02108:Ppp6r3 APN 19 3492494 missense probably damaging 1.00
IGL02227:Ppp6r3 APN 19 3518245 missense possibly damaging 0.56
IGL02427:Ppp6r3 APN 19 3466580 missense probably null
IGL02441:Ppp6r3 APN 19 3464693 missense probably benign 0.14
IGL02805:Ppp6r3 APN 19 3492428 missense probably benign 0.15
IGL03298:Ppp6r3 APN 19 3521829 missense probably damaging 0.97
PIT1430001:Ppp6r3 UTSW 19 3471059 nonsense probably null
R0324:Ppp6r3 UTSW 19 3464693 missense probably benign 0.00
R0362:Ppp6r3 UTSW 19 3478285 missense probably damaging 0.96
R1876:Ppp6r3 UTSW 19 3471971 splice site probably benign
R2860:Ppp6r3 UTSW 19 3521782 missense possibly damaging 0.49
R2861:Ppp6r3 UTSW 19 3521782 missense possibly damaging 0.49
R2862:Ppp6r3 UTSW 19 3521782 missense possibly damaging 0.49
R3958:Ppp6r3 UTSW 19 3496583 missense probably damaging 0.99
R4160:Ppp6r3 UTSW 19 3512037 missense probably damaging 0.97
R4473:Ppp6r3 UTSW 19 3511978 missense probably damaging 1.00
R4901:Ppp6r3 UTSW 19 3467229 missense probably damaging 1.00
R4996:Ppp6r3 UTSW 19 3473833 missense probably damaging 0.98
R5139:Ppp6r3 UTSW 19 3464610 missense probably damaging 1.00
R5414:Ppp6r3 UTSW 19 3507330 missense probably damaging 1.00
R5776:Ppp6r3 UTSW 19 3526901 missense possibly damaging 0.77
R6290:Ppp6r3 UTSW 19 3494011 missense probably benign
R6525:Ppp6r3 UTSW 19 3493936 missense probably damaging 0.99
R6797:Ppp6r3 UTSW 19 3514719 missense probably damaging 1.00
R6977:Ppp6r3 UTSW 19 3467272 missense probably damaging 1.00
R7176:Ppp6r3 UTSW 19 3471989 missense probably damaging 0.99
R7178:Ppp6r3 UTSW 19 3518337 missense probably benign 0.00
R7239:Ppp6r3 UTSW 19 3493981 missense probably benign 0.38
R7326:Ppp6r3 UTSW 19 3507325 missense probably damaging 1.00
R7536:Ppp6r3 UTSW 19 3507341 missense possibly damaging 0.80
R7583:Ppp6r3 UTSW 19 3490790 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGAGCATGTCACTTACCAGTC -3'
(R):5'- TTACACTGTGCAGTTGTGGAC -3'

Sequencing Primer
(F):5'- TGTCACTTACCAGTCACTCATAAGG -3'
(R):5'- TTGTGGACGAGAGAAGCTCATTAG -3'
Posted On2015-05-14