Incidental Mutation 'R4158:Ankrd1'
Institutional Source Beutler Lab
Gene Symbol Ankrd1
Ensembl Gene ENSMUSG00000024803
Gene Nameankyrin repeat domain 1 (cardiac muscle)
SynonymsMARP1, CARP, Alrp, Crap
MMRRC Submission 041001-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4158 (G1)
Quality Score225
Status Validated
Chromosomal Location36111965-36119844 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36117873 bp
Amino Acid Change Lysine to Asparagine at position 138 (K138N)
Ref Sequence ENSEMBL: ENSMUSP00000025718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025718]
Predicted Effect probably damaging
Transcript: ENSMUST00000025718
AA Change: K138N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025718
Gene: ENSMUSG00000024803
AA Change: K138N

coiled coil region 53 88 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
Blast:ANK 119 148 1e-10 BLAST
ANK 152 181 4.56e-4 SMART
ANK 185 214 3.28e-5 SMART
ANK 218 247 4.89e-4 SMART
ANK 251 280 6.92e-4 SMART
Blast:ANK 285 313 5e-8 BLAST
Meta Mutation Damage Score 0.2300 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is localized to the nucleus of endothelial cells and is induced by IL-1 and TNF-alpha stimulation. Studies in rat cardiomyocytes suggest that this gene functions as a transcription factor. Interactions between this protein and the sarcomeric proteins myopalladin and titin suggest that it may also be involved in the myofibrillar stretch-sensor system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele are viable, fertile, and show no apparent cardiac phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 43,650,817 H597R probably damaging Het
Adgrf4 G T 17: 42,667,677 H258Q probably benign Het
Arg1 T C 10: 24,922,677 E25G probably damaging Het
Arhgef19 T C 4: 141,246,349 I49T possibly damaging Het
Bsn A G 9: 108,112,946 V1869A possibly damaging Het
Cep350 G A 1: 155,932,875 R652W probably damaging Het
Cyp19a1 G A 9: 54,186,696 T94I probably damaging Het
Dnajc13 G A 9: 104,190,442 L1173F probably damaging Het
Dse A G 10: 34,153,334 F587L probably damaging Het
Efcab14 A C 4: 115,740,397 D63A probably damaging Het
Eomes A G 9: 118,478,963 T35A probably benign Het
Fbxl20 T C 11: 98,095,394 probably benign Het
Flcn T C 11: 59,801,121 N234S probably benign Het
Gm20939 A T 17: 94,876,734 Y270F possibly damaging Het
Ikzf4 A T 10: 128,643,736 probably benign Het
Iltifb T C 10: 118,293,132 T151A probably damaging Het
Kcne4 A G 1: 78,818,102 N156D probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lrrc45 A T 11: 120,718,446 D377V possibly damaging Het
Magi3 T C 3: 104,050,961 K603E probably damaging Het
Mocos T C 18: 24,674,246 I345T probably damaging Het
Nox4 A T 7: 87,396,824 H557L possibly damaging Het
Oasl1 A G 5: 114,937,014 K378E possibly damaging Het
Pla2r1 A T 2: 60,422,622 I1375K probably damaging Het
Ppp6r3 T A 19: 3,512,037 H208L probably damaging Het
Ptprz1 A T 6: 23,001,684 K1258* probably null Het
Ptprz1 T C 6: 23,022,205 I844T possibly damaging Het
Sdk1 A G 5: 142,114,399 I1395V probably benign Het
Sec31b T C 19: 44,525,186 N470S probably benign Het
Slc26a7 T C 4: 14,544,197 T369A probably benign Het
Tex14 T G 11: 87,516,769 S900R probably benign Het
Ush2a G A 1: 188,728,710 V2723M probably damaging Het
Vat1l T A 8: 114,371,729 M413K probably benign Het
Zfp981 C A 4: 146,537,623 P335Q probably benign Het
Zfp981 T A 4: 146,537,882 H421Q probably benign Het
Other mutations in Ankrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02210:Ankrd1 APN 19 36118314 missense probably damaging 1.00
IGL02383:Ankrd1 APN 19 36119765 missense probably benign 0.25
IGL02538:Ankrd1 APN 19 36115056 missense probably damaging 1.00
R0143:Ankrd1 UTSW 19 36119313 missense probably benign 0.07
R1302:Ankrd1 UTSW 19 36115003 missense probably damaging 1.00
R1800:Ankrd1 UTSW 19 36119359 missense probably damaging 1.00
R1832:Ankrd1 UTSW 19 36114978 missense possibly damaging 0.94
R1855:Ankrd1 UTSW 19 36119235 missense probably damaging 1.00
R4160:Ankrd1 UTSW 19 36117873 missense probably damaging 1.00
R4161:Ankrd1 UTSW 19 36117873 missense probably damaging 1.00
R4930:Ankrd1 UTSW 19 36115033 missense probably damaging 0.99
R5929:Ankrd1 UTSW 19 36117877 missense possibly damaging 0.94
R7057:Ankrd1 UTSW 19 36118233 missense possibly damaging 0.78
R7836:Ankrd1 UTSW 19 36115522 missense possibly damaging 0.93
R7846:Ankrd1 UTSW 19 36116818 missense probably damaging 0.99
R7919:Ankrd1 UTSW 19 36115522 missense possibly damaging 0.93
R7929:Ankrd1 UTSW 19 36116818 missense probably damaging 0.99
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-05-14