Incidental Mutation 'R4159:Spef2'
ID315670
Institutional Source Beutler Lab
Gene Symbol Spef2
Ensembl Gene ENSMUSG00000072663
Gene Namesperm flagellar 2
SynonymsC230086A09Rik
MMRRC Submission 041002-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R4159 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location9578193-9748868 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 9676321 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 721 (D721E)
Ref Sequence ENSEMBL: ENSMUSP00000124222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041840] [ENSMUST00000160236] [ENSMUST00000208854]
Predicted Effect probably damaging
Transcript: ENSMUST00000041840
AA Change: D721E

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000035762
Gene: ENSMUSG00000072663
AA Change: D721E

DomainStartEndE-ValueType
Pfam:DUF1042 5 161 2.8e-59 PFAM
coiled coil region 171 203 N/A INTRINSIC
low complexity region 247 256 N/A INTRINSIC
coiled coil region 312 345 N/A INTRINSIC
Pfam:ADK 600 829 5.9e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160236
AA Change: D721E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124222
Gene: ENSMUSG00000072663
AA Change: D721E

DomainStartEndE-ValueType
Pfam:DUF1042 5 160 4.6e-59 PFAM
coiled coil region 171 203 N/A INTRINSIC
low complexity region 247 256 N/A INTRINSIC
coiled coil region 312 345 N/A INTRINSIC
Pfam:ADK 600 787 3.7e-10 PFAM
low complexity region 819 855 N/A INTRINSIC
low complexity region 899 907 N/A INTRINSIC
low complexity region 1201 1225 N/A INTRINSIC
low complexity region 1254 1268 N/A INTRINSIC
low complexity region 1349 1359 N/A INTRINSIC
SCOP:d1rec__ 1368 1520 3e-3 SMART
low complexity region 1595 1614 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000208854
AA Change: D721E

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.4317 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 96% (45/47)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit male infertility due to oligospermia and abnormal spermatogenesis, hydroencephaly, sinusitis, and background-dependent lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G A 17: 33,066,049 T593I probably benign Het
4932438A13Rik T A 3: 36,931,083 M854K probably benign Het
Adam4 T G 12: 81,420,032 D605A probably damaging Het
Adcy1 A G 11: 7,063,889 H97R probably damaging Het
Amdhd1 A G 10: 93,534,650 Y109H probably damaging Het
Ankhd1 A G 18: 36,589,540 N372S possibly damaging Het
Aoc2 G A 11: 101,325,296 M68I probably damaging Het
Aspscr1 G A 11: 120,708,676 A377T probably damaging Het
Cacnb1 G C 11: 98,012,274 C154W probably damaging Het
Ccdc186 G A 19: 56,793,492 R27* probably null Het
Clnk C A 5: 38,741,795 probably benign Het
Dse A G 10: 34,153,334 F587L probably damaging Het
Fut8 T C 12: 77,393,749 L170P probably damaging Het
G3bp2 T C 5: 92,064,401 H217R probably benign Het
Gm19345 G A 7: 19,854,961 probably benign Het
Hjurp G C 1: 88,277,215 probably benign Het
Kcne4 A G 1: 78,818,102 N156D probably benign Het
Met G T 6: 17,562,272 probably null Het
Mfsd3 T C 15: 76,701,745 L26P probably damaging Het
Oasl1 A G 5: 114,937,014 K378E possibly damaging Het
Pde8a A G 7: 81,320,659 I510V probably benign Het
Pds5a T C 5: 65,664,496 T120A possibly damaging Het
Phkb T A 8: 86,021,533 probably null Het
Ptprz1 A T 6: 23,001,684 K1258* probably null Het
Senp7 C A 16: 56,153,469 P351Q possibly damaging Het
Slc15a5 G T 6: 138,072,940 T159K possibly damaging Het
Slc39a6 A G 18: 24,597,828 V362A possibly damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tmem173 A T 18: 35,739,219 Y77N probably damaging Het
Tnxb A G 17: 34,711,517 T2059A probably damaging Het
Ttll8 T C 15: 88,917,241 N415D probably benign Het
Ube2d2a A T 18: 35,770,524 probably benign Het
Uhrf1bp1 A G 17: 27,884,087 Y365C probably damaging Het
Unc79 A G 12: 103,070,253 probably benign Het
Ush2a G A 1: 188,728,710 V2723M probably damaging Het
Vmn2r102 T A 17: 19,677,826 C368S probably damaging Het
Vmn2r3 G A 3: 64,287,429 Q23* probably null Het
Other mutations in Spef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Spef2 APN 15 9740535 missense probably damaging 1.00
IGL00886:Spef2 APN 15 9663095 missense probably damaging 1.00
IGL01409:Spef2 APN 15 9716413 missense probably damaging 1.00
IGL01413:Spef2 APN 15 9676290 missense probably benign 0.16
IGL01474:Spef2 APN 15 9663158 missense probably benign 0.00
IGL01603:Spef2 APN 15 9704380 missense probably damaging 0.99
IGL02320:Spef2 APN 15 9717576 missense probably damaging 0.99
IGL02570:Spef2 APN 15 9717498 nonsense probably null
IGL02605:Spef2 APN 15 9725152 missense probably damaging 0.99
IGL02890:Spef2 APN 15 9748767 start codon destroyed probably null 1.00
IGL02904:Spef2 APN 15 9679346 missense probably damaging 1.00
IGL02942:Spef2 APN 15 9668874 missense possibly damaging 0.71
IGL02953:Spef2 APN 15 9713243 missense possibly damaging 0.82
IGL02965:Spef2 APN 15 9725106 splice site probably benign
IGL03263:Spef2 APN 15 9667219 missense possibly damaging 0.72
IGL03302:Spef2 APN 15 9676380 missense probably benign 0.01
R0101:Spef2 UTSW 15 9713108 missense probably damaging 1.00
R0101:Spef2 UTSW 15 9713108 missense probably damaging 1.00
R0183:Spef2 UTSW 15 9716359 missense possibly damaging 0.70
R0386:Spef2 UTSW 15 9584062 missense probably damaging 1.00
R0511:Spef2 UTSW 15 9583984 critical splice donor site probably null
R0617:Spef2 UTSW 15 9592758 missense probably damaging 1.00
R0655:Spef2 UTSW 15 9626131 missense possibly damaging 0.96
R0829:Spef2 UTSW 15 9687813 missense probably benign 0.10
R0908:Spef2 UTSW 15 9614195 splice site probably null
R0939:Spef2 UTSW 15 9704550 splice site probably null
R0973:Spef2 UTSW 15 9716396 missense probably damaging 1.00
R1371:Spef2 UTSW 15 9725108 splice site probably benign
R1392:Spef2 UTSW 15 9647263 missense probably benign 0.15
R1392:Spef2 UTSW 15 9647263 missense probably benign 0.15
R1428:Spef2 UTSW 15 9596707 unclassified probably benign
R1518:Spef2 UTSW 15 9667230 missense probably damaging 1.00
R1585:Spef2 UTSW 15 9596574 missense probably damaging 1.00
R1654:Spef2 UTSW 15 9634652 missense probably damaging 0.99
R1723:Spef2 UTSW 15 9614209 missense probably damaging 1.00
R1757:Spef2 UTSW 15 9717482 missense probably damaging 1.00
R1812:Spef2 UTSW 15 9679349 missense probably damaging 1.00
R1817:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1818:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1873:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1875:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1875:Spef2 UTSW 15 9597401 missense possibly damaging 0.78
R1897:Spef2 UTSW 15 9729654 nonsense probably null
R1901:Spef2 UTSW 15 9607377 missense probably damaging 1.00
R1902:Spef2 UTSW 15 9607377 missense probably damaging 1.00
R1943:Spef2 UTSW 15 9663194 missense possibly damaging 0.76
R1968:Spef2 UTSW 15 9609516 missense probably damaging 1.00
R1973:Spef2 UTSW 15 9663066 makesense probably null
R1998:Spef2 UTSW 15 9668903 critical splice acceptor site probably null
R1999:Spef2 UTSW 15 9668903 critical splice acceptor site probably null
R2008:Spef2 UTSW 15 9713185 missense possibly damaging 0.95
R2111:Spef2 UTSW 15 9589573 missense probably damaging 1.00
R2127:Spef2 UTSW 15 9729661 missense possibly damaging 0.53
R2405:Spef2 UTSW 15 9626034 nonsense probably null
R2517:Spef2 UTSW 15 9725197 missense possibly damaging 0.93
R2889:Spef2 UTSW 15 9630613 missense probably damaging 0.99
R2988:Spef2 UTSW 15 9682623 missense probably benign 0.43
R3792:Spef2 UTSW 15 9704536 missense probably damaging 1.00
R4154:Spef2 UTSW 15 9626021 missense probably benign 0.13
R4199:Spef2 UTSW 15 9667280 missense probably damaging 1.00
R4320:Spef2 UTSW 15 9679343 missense possibly damaging 0.93
R4321:Spef2 UTSW 15 9679343 missense possibly damaging 0.93
R4568:Spef2 UTSW 15 9647217 missense probably damaging 1.00
R4625:Spef2 UTSW 15 9647438 missense probably damaging 1.00
R4669:Spef2 UTSW 15 9676373 missense probably benign 0.42
R4684:Spef2 UTSW 15 9647490 missense probably benign 0.44
R4761:Spef2 UTSW 15 9652954 missense probably damaging 1.00
R4839:Spef2 UTSW 15 9713178 nonsense probably null
R5004:Spef2 UTSW 15 9578327 missense probably benign 0.02
R5157:Spef2 UTSW 15 9668791 nonsense probably null
R5230:Spef2 UTSW 15 9667230 missense possibly damaging 0.62
R5315:Spef2 UTSW 15 9596691 missense probably damaging 0.98
R5400:Spef2 UTSW 15 9614281 missense probably damaging 1.00
R5591:Spef2 UTSW 15 9583836 missense probably benign 0.02
R5599:Spef2 UTSW 15 9729703 missense possibly damaging 0.53
R5605:Spef2 UTSW 15 9609520 missense probably damaging 0.96
R5787:Spef2 UTSW 15 9748726 missense possibly damaging 0.91
R5939:Spef2 UTSW 15 9614215 missense probably benign 0.16
R6177:Spef2 UTSW 15 9727532 missense possibly damaging 0.89
R6641:Spef2 UTSW 15 9625973 missense probably damaging 1.00
R6665:Spef2 UTSW 15 9600518 critical splice donor site probably null
R6944:Spef2 UTSW 15 9592749 missense probably damaging 1.00
R6956:Spef2 UTSW 15 9684935 missense probably damaging 1.00
R6968:Spef2 UTSW 15 9597340 missense probably benign 0.02
R7089:Spef2 UTSW 15 9725171 missense probably damaging 1.00
R7117:Spef2 UTSW 15 9729838 missense probably damaging 1.00
R7161:Spef2 UTSW 15 9717603 missense probably benign 0.29
R7223:Spef2 UTSW 15 9601640 missense unknown
R7263:Spef2 UTSW 15 9653012 synonymous probably null
R7270:Spef2 UTSW 15 9599980 critical splice donor site probably null
R7303:Spef2 UTSW 15 9647490 missense possibly damaging 0.92
R7369:Spef2 UTSW 15 9584207 missense probably benign 0.02
R7464:Spef2 UTSW 15 9740585 missense probably benign 0.23
R7498:Spef2 UTSW 15 9727539 missense probably benign
R7587:Spef2 UTSW 15 9713219 missense probably damaging 1.00
R7748:Spef2 UTSW 15 9652945 missense probably damaging 0.98
R7772:Spef2 UTSW 15 9704481 missense probably damaging 0.99
X0025:Spef2 UTSW 15 9596622 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGCCAGCTTCATGTTCTC -3'
(R):5'- GATACCTGTGGACCAAAGCTG -3'

Sequencing Primer
(F):5'- GCCAGCTTCATGTTCTCTTGCTC -3'
(R):5'- CCAAAGCTGGGTTCTTGATGGATTTC -3'
Posted On2015-05-14