Incidental Mutation 'R4159:Mfsd3'
ID315671
Institutional Source Beutler Lab
Gene Symbol Mfsd3
Ensembl Gene ENSMUSG00000019080
Gene Namemajor facilitator superfamily domain containing 3
Synonyms
MMRRC Submission 041002-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R4159 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location76701465-76704239 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76701745 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 26 (L26P)
Ref Sequence ENSEMBL: ENSMUSP00000019224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019224] [ENSMUST00000023203] [ENSMUST00000036852] [ENSMUST00000229140] [ENSMUST00000229679] [ENSMUST00000229734] [ENSMUST00000230544] [ENSMUST00000230724] [ENSMUST00000231028]
Predicted Effect probably damaging
Transcript: ENSMUST00000019224
AA Change: L26P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019224
Gene: ENSMUSG00000019080
AA Change: L26P

DomainStartEndE-ValueType
Pfam:MFS_1 8 373 3e-16 PFAM
transmembrane domain 388 407 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000023203
SMART Domains Protein: ENSMUSP00000023203
Gene: ENSMUSG00000022546

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 83 484 7.8e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000036852
SMART Domains Protein: ENSMUSP00000044363
Gene: ENSMUSG00000033762

DomainStartEndE-ValueType
Pfam:Drc1-Sld2 4 132 2.8e-14 PFAM
low complexity region 169 187 N/A INTRINSIC
low complexity region 368 379 N/A INTRINSIC
ZnF_C2HC 394 410 5.67e-5 SMART
DEXDc 494 701 5.86e-28 SMART
HELICc 736 831 1.48e-24 SMART
Blast:DEXDc 902 1117 3e-46 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228987
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229018
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229098
Predicted Effect probably benign
Transcript: ENSMUST00000229140
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229340
Predicted Effect probably benign
Transcript: ENSMUST00000229679
Predicted Effect probably benign
Transcript: ENSMUST00000229734
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229856
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230283
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230482
Predicted Effect probably benign
Transcript: ENSMUST00000230544
Predicted Effect probably benign
Transcript: ENSMUST00000230724
Predicted Effect probably benign
Transcript: ENSMUST00000231028
Meta Mutation Damage Score 0.8593 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 96% (45/47)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G A 17: 33,066,049 T593I probably benign Het
4932438A13Rik T A 3: 36,931,083 M854K probably benign Het
Adam4 T G 12: 81,420,032 D605A probably damaging Het
Adcy1 A G 11: 7,063,889 H97R probably damaging Het
Amdhd1 A G 10: 93,534,650 Y109H probably damaging Het
Ankhd1 A G 18: 36,589,540 N372S possibly damaging Het
Aoc2 G A 11: 101,325,296 M68I probably damaging Het
Aspscr1 G A 11: 120,708,676 A377T probably damaging Het
Cacnb1 G C 11: 98,012,274 C154W probably damaging Het
Ccdc186 G A 19: 56,793,492 R27* probably null Het
Clnk C A 5: 38,741,795 probably benign Het
Dse A G 10: 34,153,334 F587L probably damaging Het
Fut8 T C 12: 77,393,749 L170P probably damaging Het
G3bp2 T C 5: 92,064,401 H217R probably benign Het
Gm19345 G A 7: 19,854,961 probably benign Het
Hjurp G C 1: 88,277,215 probably benign Het
Kcne4 A G 1: 78,818,102 N156D probably benign Het
Met G T 6: 17,562,272 probably null Het
Oasl1 A G 5: 114,937,014 K378E possibly damaging Het
Pde8a A G 7: 81,320,659 I510V probably benign Het
Pds5a T C 5: 65,664,496 T120A possibly damaging Het
Phkb T A 8: 86,021,533 probably null Het
Ptprz1 A T 6: 23,001,684 K1258* probably null Het
Senp7 C A 16: 56,153,469 P351Q possibly damaging Het
Slc15a5 G T 6: 138,072,940 T159K possibly damaging Het
Slc39a6 A G 18: 24,597,828 V362A possibly damaging Het
Spef2 A T 15: 9,676,321 D721E probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tmem173 A T 18: 35,739,219 Y77N probably damaging Het
Tnxb A G 17: 34,711,517 T2059A probably damaging Het
Ttll8 T C 15: 88,917,241 N415D probably benign Het
Ube2d2a A T 18: 35,770,524 probably benign Het
Uhrf1bp1 A G 17: 27,884,087 Y365C probably damaging Het
Unc79 A G 12: 103,070,253 probably benign Het
Ush2a G A 1: 188,728,710 V2723M probably damaging Het
Vmn2r102 T A 17: 19,677,826 C368S probably damaging Het
Vmn2r3 G A 3: 64,287,429 Q23* probably null Het
Other mutations in Mfsd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02965:Mfsd3 APN 15 76703152 missense probably benign 0.01
IGL03159:Mfsd3 APN 15 76702901 missense probably benign
R1232:Mfsd3 UTSW 15 76703182 missense probably damaging 1.00
R1389:Mfsd3 UTSW 15 76702689 missense probably benign 0.01
R1535:Mfsd3 UTSW 15 76702779 missense probably damaging 1.00
R4993:Mfsd3 UTSW 15 76701982 missense probably damaging 1.00
R5307:Mfsd3 UTSW 15 76702171 nonsense probably null
R6902:Mfsd3 UTSW 15 76703149 missense probably damaging 1.00
R6946:Mfsd3 UTSW 15 76703149 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATTTCTGGTCCCAGTGTGC -3'
(R):5'- CCAGATTCAGCAGCAGTAGC -3'

Sequencing Primer
(F):5'- CGTGTCGGGATTACAGCCTG -3'
(R):5'- ATCACGGTGGTAGGTAGCC -3'
Posted On2015-05-14