Incidental Mutation 'R4160:Cacnb3'
ID315712
Institutional Source Beutler Lab
Gene Symbol Cacnb3
Ensembl Gene ENSMUSG00000003352
Gene Namecalcium channel, voltage-dependent, beta 3 subunit
SynonymsCchb3, Beta3
MMRRC Submission 041003-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.478) question?
Stock #R4160 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location98630840-98644529 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 98640720 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 148 (G148C)
Ref Sequence ENSEMBL: ENSMUSP00000003442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003442] [ENSMUST00000003450] [ENSMUST00000109150] [ENSMUST00000230490]
Predicted Effect probably damaging
Transcript: ENSMUST00000003442
AA Change: G148C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003442
Gene: ENSMUSG00000003352
AA Change: G148C

DomainStartEndE-ValueType
Pfam:VGCC_beta4Aa_N 16 58 8.7e-22 PFAM
SH3 62 125 1.04e0 SMART
GuKc 176 357 1.3e-32 SMART
low complexity region 363 379 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000003450
SMART Domains Protein: ENSMUSP00000003450
Gene: ENSMUSG00000003360

DomainStartEndE-ValueType
coiled coil region 63 93 N/A INTRINSIC
low complexity region 110 130 N/A INTRINSIC
low complexity region 143 159 N/A INTRINSIC
coiled coil region 161 200 N/A INTRINSIC
low complexity region 210 223 N/A INTRINSIC
coiled coil region 320 352 N/A INTRINSIC
DEXDc 409 641 2.95e-65 SMART
HELICc 677 758 2.43e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109150
AA Change: G147C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104778
Gene: ENSMUSG00000003352
AA Change: G147C

DomainStartEndE-ValueType
Pfam:VGCC_beta4Aa_N 15 57 2.2e-21 PFAM
SH3 61 124 1.04e0 SMART
GuKc 175 356 1.3e-32 SMART
low complexity region 362 378 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229223
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230064
Predicted Effect probably damaging
Transcript: ENSMUST00000230490
AA Change: G148C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230769
Meta Mutation Damage Score 0.088 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 89% (34/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulatory beta subunit of the voltage-dependent calcium channel. Beta subunits are composed of five domains, which contribute to the regulation of surface expression and gating of calcium channels and may also play a role in the regulation of transcription factors and calcium transport. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygotes for a null allele show altered Ca2+ channel activity, hyporesponsiveness to DHP, high blood pressure on a high salt diet, and impaired calcium responses and cytokine production in CD4 T cells. Homozygotes for another null allele show enhancedNMDA activity and long term potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G A 17: 33,066,049 T593I probably benign Het
Adgrf4 G T 17: 42,667,677 H258Q probably benign Het
Ankrd1 T A 19: 36,117,873 K138N probably damaging Het
Arhgef19 T C 4: 141,246,349 I49T possibly damaging Het
Cep350 G A 1: 155,932,875 R652W probably damaging Het
Cyp19a1 G A 9: 54,186,696 T94I probably damaging Het
D130043K22Rik A C 13: 24,862,696 E360D probably benign Het
Dse A G 10: 34,153,334 F587L probably damaging Het
Efcab14 A C 4: 115,740,397 D63A probably damaging Het
Ibtk T C 9: 85,703,090 E1167G probably benign Het
Ikzf4 A T 10: 128,643,736 probably benign Het
Magi3 T C 3: 104,050,961 K603E probably damaging Het
Myh13 T C 11: 67,364,810 probably benign Het
Nox4 A T 7: 87,396,824 H557L possibly damaging Het
Oasl1 A G 5: 114,937,014 K378E possibly damaging Het
Pdia3 A T 2: 121,414,115 D26V probably damaging Het
Pds5a T C 5: 65,664,496 T120A possibly damaging Het
Pkn2 G A 3: 142,803,564 P740S probably benign Het
Pla2r1 A T 2: 60,422,622 I1375K probably damaging Het
Pld2 T C 11: 70,541,427 L124P probably damaging Het
Ppp6r3 T A 19: 3,512,037 H208L probably damaging Het
Prr36 G T 8: 4,212,910 Q919K probably benign Het
Ptpn1 T C 2: 167,967,811 I113T probably benign Het
Ptprz1 T C 6: 23,022,205 I844T possibly damaging Het
Rbl1 A G 2: 157,192,119 probably benign Het
Sdk1 A G 5: 142,114,399 I1395V probably benign Het
Senp7 C A 16: 56,153,469 P351Q possibly damaging Het
Slc26a7 T C 4: 14,544,197 T369A probably benign Het
Tnxb A G 17: 34,711,517 T2059A probably damaging Het
Uhrf1bp1 A G 17: 27,884,087 Y365C probably damaging Het
Vat1l T A 8: 114,371,729 M413K probably benign Het
Vps11 C G 9: 44,355,720 G406A probably damaging Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Other mutations in Cacnb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01142:Cacnb3 APN 15 98642002 nonsense probably null
IGL01298:Cacnb3 APN 15 98639853 missense probably damaging 1.00
IGL01535:Cacnb3 APN 15 98639588 missense probably benign 0.02
IGL01537:Cacnb3 APN 15 98643420 missense probably damaging 1.00
IGL02304:Cacnb3 APN 15 98642382 missense probably damaging 1.00
IGL02349:Cacnb3 APN 15 98640961 nonsense probably null
R0270:Cacnb3 UTSW 15 98642559 missense probably damaging 0.98
R1677:Cacnb3 UTSW 15 98642574 missense probably damaging 1.00
R3407:Cacnb3 UTSW 15 98641187 missense probably benign 0.19
R3408:Cacnb3 UTSW 15 98641187 missense probably benign 0.19
R5123:Cacnb3 UTSW 15 98639869 missense probably damaging 1.00
R5356:Cacnb3 UTSW 15 98641617 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CACTTAGCACTGCGCCCAC -3'
(R):5'- GCTTGGGAGTCCCTTCCC -3'

Sequencing Primer
(F):5'- CCACAGAACACAGCTATACATTTAC -3'
(R):5'- CCTGGGGAGGTAACAGGCTC -3'
Posted On2015-05-14