Incidental Mutation 'R0390:Sema6d'
ID 31572
Institutional Source Beutler Lab
Gene Symbol Sema6d
Ensembl Gene ENSMUSG00000027200
Gene Name sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D
Synonyms Sema6D-6, 1110067B02Rik, Sema6D-1, Sema6D-2, Sema6D-4, Sema6D-5
MMRRC Submission 038596-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0390 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 124089969-124667770 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 124658490 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 393 (I393N)
Ref Sequence ENSEMBL: ENSMUSP00000099531 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051419] [ENSMUST00000076335] [ENSMUST00000077847] [ENSMUST00000078621] [ENSMUST00000103238] [ENSMUST00000103239] [ENSMUST00000103240] [ENSMUST00000103241]
AlphaFold Q76KF0
Predicted Effect probably damaging
Transcript: ENSMUST00000051419
AA Change: I393N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061123
Gene: ENSMUSG00000027200
AA Change: I393N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 582 4.57e-1 SMART
transmembrane domain 602 624 N/A INTRINSIC
low complexity region 743 764 N/A INTRINSIC
internal_repeat_1 797 898 7.43e-5 PROSPERO
internal_repeat_1 892 1004 7.43e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000076335
AA Change: I393N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075674
Gene: ENSMUSG00000027200
AA Change: I393N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 569 1.12e-1 SMART
transmembrane domain 589 611 N/A INTRINSIC
low complexity region 730 751 N/A INTRINSIC
internal_repeat_1 784 885 7.28e-5 PROSPERO
internal_repeat_1 879 991 7.28e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000077847
AA Change: I393N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077014
Gene: ENSMUSG00000027200
AA Change: I393N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 569 1.12e-1 SMART
low complexity region 573 584 N/A INTRINSIC
transmembrane domain 645 667 N/A INTRINSIC
low complexity region 786 807 N/A INTRINSIC
internal_repeat_1 840 941 5.95e-5 PROSPERO
internal_repeat_1 935 1047 5.95e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000078621
AA Change: I393N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077691
Gene: ENSMUSG00000027200
AA Change: I393N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 582 4.57e-1 SMART
transmembrane domain 621 643 N/A INTRINSIC
low complexity region 762 783 N/A INTRINSIC
internal_repeat_1 816 917 8.83e-5 PROSPERO
internal_repeat_1 911 1023 8.83e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000103238
AA Change: I393N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099528
Gene: ENSMUSG00000027200
AA Change: I393N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 569 1.12e-1 SMART
low complexity region 573 584 N/A INTRINSIC
transmembrane domain 645 667 N/A INTRINSIC
low complexity region 786 807 N/A INTRINSIC
internal_repeat_1 840 941 5.95e-5 PROSPERO
internal_repeat_1 935 1047 5.95e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000103239
AA Change: I393N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099529
Gene: ENSMUSG00000027200
AA Change: I393N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 569 1.12e-1 SMART
low complexity region 587 603 N/A INTRINSIC
transmembrane domain 664 686 N/A INTRINSIC
low complexity region 805 826 N/A INTRINSIC
internal_repeat_1 859 960 5.78e-5 PROSPERO
internal_repeat_1 954 1066 5.78e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000103240
AA Change: I393N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099530
Gene: ENSMUSG00000027200
AA Change: I393N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 569 1.12e-1 SMART
low complexity region 587 603 N/A INTRINSIC
transmembrane domain 660 682 N/A INTRINSIC
low complexity region 801 822 N/A INTRINSIC
internal_repeat_1 855 956 5.63e-5 PROSPERO
internal_repeat_1 950 1062 5.63e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000103241
AA Change: I393N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099531
Gene: ENSMUSG00000027200
AA Change: I393N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 569 1.12e-1 SMART
transmembrane domain 589 611 N/A INTRINSIC
low complexity region 730 751 N/A INTRINSIC
internal_repeat_1 784 885 7.28e-5 PROSPERO
internal_repeat_1 879 991 7.28e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132088
Meta Mutation Damage Score 0.9305 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 92.0%
Validation Efficiency 98% (110/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Semaphorins are a large family, including both secreted and membrane associated proteins, many of which have been implicated as inhibitors or chemorepellents in axon pathfinding, fasciculation and branching, and target selection. All semaphorins possess a semaphorin (Sema) domain and a PSI domain (found in plexins, semaphorins and integrins) in the N-terminal extracellular portion. Additional sequence motifs C-terminal to the semaphorin domain allow classification into distinct subfamilies. Results demonstrate that transmembrane semaphorins, like the secreted ones, can act as repulsive axon guidance cues. This gene encodes a class 6 vertebrate transmembrane semaphorin that demonstrates alternative splicing. Several transcript variants have been identified and expression of the distinct encoded isoforms is thought to be regulated in a tissue- and development-dependent manner. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal dendritic cell trafficking and antigen-specific T cell priming. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730017C20Rik T A 18: 59,075,688 V136E probably damaging Het
Adam18 C T 8: 24,674,054 G38R probably benign Het
Ap2m1 T C 16: 20,541,099 M183T probably damaging Het
Apob A T 12: 7,988,678 I364F probably damaging Het
Arl6 A T 16: 59,622,421 probably benign Het
Cand2 A G 6: 115,774,653 M15V possibly damaging Het
Cbl A G 9: 44,201,005 F131S probably damaging Het
Ccdc151 T A 9: 21,991,708 H442L probably benign Het
Ccdc74a A G 16: 17,650,476 S321G probably benign Het
Cdc14b T C 13: 64,210,192 probably benign Het
Cep152 T C 2: 125,576,869 probably benign Het
Cep290 A G 10: 100,508,758 E479G probably benign Het
Chrm2 T G 6: 36,524,111 I301R probably benign Het
Clec2e A G 6: 129,093,468 W197R probably damaging Het
Cnot10 G T 9: 114,629,150 S96* probably null Het
Col19a1 A G 1: 24,289,655 probably benign Het
Csmd2 T C 4: 128,133,673 probably benign Het
Cthrc1 A T 15: 39,086,764 *172L probably null Het
Cul9 A T 17: 46,528,589 I821N probably benign Het
Daam1 G C 12: 71,975,304 probably benign Het
Dhx58 A T 11: 100,699,264 I398N probably damaging Het
Dip2b T A 15: 100,193,913 H844Q probably damaging Het
Dmac2 A G 7: 25,621,029 D50G probably damaging Het
Dmxl1 C A 18: 49,879,362 Q1529K probably benign Het
Dtna C T 18: 23,597,501 P315L probably damaging Het
Ep300 T C 15: 81,640,116 S1382P unknown Het
Fat2 A T 11: 55,310,777 N490K probably damaging Het
Flg2 T A 3: 93,200,355 probably benign Het
Gm13084 T A 4: 143,811,699 D234V probably benign Het
Gpatch1 T C 7: 35,281,381 probably benign Het
Grin2a C A 16: 9,579,585 K879N possibly damaging Het
Hacd3 A C 9: 65,001,022 I164S possibly damaging Het
Hinfp A C 9: 44,298,948 C197G probably damaging Het
Hsd17b12 T C 2: 94,114,990 probably benign Het
Hsd3b1 A T 3: 98,853,039 L212Q probably damaging Het
Ifrd1 C T 12: 40,214,094 probably null Het
Igf2bp2 A G 16: 22,081,801 F129L possibly damaging Het
Kirrel3 T A 9: 35,020,163 I409N probably damaging Het
Klhdc10 T C 6: 30,447,412 I204T probably damaging Het
Kpna6 A T 4: 129,657,804 S65R possibly damaging Het
Lama3 A T 18: 12,407,563 D308V probably benign Het
Larp4b T A 13: 9,158,107 probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lyzl1 A T 18: 4,169,175 T11S probably benign Het
Man1c1 A G 4: 134,578,315 L366P probably damaging Het
Mef2a A G 7: 67,251,724 M100T probably damaging Het
Mettl13 G A 1: 162,538,889 H474Y possibly damaging Het
Mmp3 A G 9: 7,451,320 D352G probably benign Het
Mns1 T C 9: 72,452,804 I412T probably damaging Het
Mon2 T C 10: 123,007,021 D1501G probably null Het
Mylk G T 16: 34,875,620 G242W probably damaging Het
Nav1 T C 1: 135,449,966 D1715G possibly damaging Het
Nckap1l T C 15: 103,453,883 S2P probably damaging Het
Nek3 A T 8: 22,128,729 probably benign Het
Nfrkb A G 9: 31,388,897 probably benign Het
Nlrp4d T C 7: 10,388,778 D53G probably benign Het
Nol8 T C 13: 49,662,152 S561P probably damaging Het
Nuf2 A C 1: 169,525,297 probably benign Het
Ofcc1 T A 13: 40,015,313 D866V possibly damaging Het
Olfr195 A G 16: 59,149,299 I150V probably benign Het
Optn A G 2: 5,046,195 L125P probably benign Het
Otoa T A 7: 121,131,341 F588Y probably benign Het
Pappa T A 4: 65,351,613 probably null Het
Pde5a T G 3: 122,835,583 C635W probably damaging Het
Pdgfb A T 15: 80,003,419 probably null Het
Pih1d2 T A 9: 50,621,046 C135S probably damaging Het
Plcg1 G T 2: 160,752,366 C361F probably damaging Het
Ppp4r4 T C 12: 103,601,360 probably benign Het
Prdm10 G A 9: 31,349,268 probably null Het
Prex2 T A 1: 11,089,706 probably null Het
Prss56 T G 1: 87,184,730 probably null Het
Prtg A G 9: 72,844,958 K209E probably benign Het
Ptprc G A 1: 138,122,575 T36I possibly damaging Het
Rasgrp4 A G 7: 29,145,860 Y302C probably damaging Het
Rb1cc1 T A 1: 6,248,634 M759K probably damaging Het
Rbm15b T A 9: 106,885,998 M324L probably benign Het
Rcbtb2 T C 14: 73,178,547 V500A probably damaging Het
Rgs6 A G 12: 83,133,677 K434R probably damaging Het
Rims1 C T 1: 22,596,526 A125T possibly damaging Het
Robo3 A G 9: 37,422,177 V746A probably benign Het
Rtl1 C T 12: 109,591,386 E1340K unknown Het
Sacs G A 14: 61,205,640 D1712N possibly damaging Het
Samd4b G A 7: 28,403,977 P19S probably benign Het
Samhd1 T C 2: 157,114,231 Y347C probably damaging Het
Sigmar1 C T 4: 41,741,243 A4T probably benign Het
Skint9 C A 4: 112,389,179 L245F probably benign Het
Slc35f5 T C 1: 125,585,095 L372P probably damaging Het
Smc1b A T 15: 85,066,277 I1182N probably damaging Het
Smyd3 A G 1: 178,957,573 probably benign Het
Sptlc1 T C 13: 53,337,612 D417G probably benign Het
Sv2c T C 13: 96,088,708 N31S probably benign Het
Tjp1 T C 7: 65,314,990 D811G probably damaging Het
Top2b A G 14: 16,418,442 T1221A probably benign Het
Tph2 T C 10: 115,174,109 D182G probably damaging Het
Traf6 C T 2: 101,688,588 Q141* probably null Het
Ttn T C 2: 76,756,931 D21574G probably damaging Het
Uba2 T A 7: 34,151,021 N367I probably benign Het
Ube2b T C 11: 51,988,602 probably benign Het
Ubr5 G T 15: 38,030,672 L426I probably benign Het
Ugt2a2 T A 5: 87,464,148 H301L probably benign Het
Upf2 T A 2: 6,018,894 probably benign Het
Utrn T C 10: 12,710,060 D991G probably benign Het
Vmn2r25 T C 6: 123,823,181 D734G probably damaging Het
Vmn2r68 T A 7: 85,233,249 probably benign Het
Vmn2r68 C G 7: 85,233,258 probably null Het
Vwf T A 6: 125,626,361 Y891* probably null Het
Wwox C T 8: 114,706,278 T228I probably benign Het
Zer1 C T 2: 30,108,213 probably benign Het
Zfp180 C T 7: 24,104,707 H184Y possibly damaging Het
Zfp68 A T 5: 138,607,225 Y279N probably benign Het
Other mutations in Sema6d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Sema6d APN 2 124659865 missense possibly damaging 0.91
IGL00508:Sema6d APN 2 124656924 splice site probably benign
IGL00710:Sema6d APN 2 124662288 missense probably benign 0.00
IGL00811:Sema6d APN 2 124658469 missense probably damaging 1.00
IGL01457:Sema6d APN 2 124653642 missense unknown
IGL01524:Sema6d APN 2 124664075 missense possibly damaging 0.86
IGL01598:Sema6d APN 2 124665098 missense probably damaging 1.00
IGL01915:Sema6d APN 2 124658571 splice site probably benign
IGL02365:Sema6d APN 2 124656868 missense probably benign 0.14
IGL02698:Sema6d APN 2 124653723 missense possibly damaging 0.95
IGL02865:Sema6d APN 2 124664073 missense probably damaging 1.00
IGL03018:Sema6d APN 2 124659600 missense possibly damaging 0.95
IGL03333:Sema6d APN 2 124664370 missense possibly damaging 0.83
R0269:Sema6d UTSW 2 124660745 missense possibly damaging 0.63
R0541:Sema6d UTSW 2 124665277 missense probably benign 0.25
R0615:Sema6d UTSW 2 124654135 splice site probably benign
R0617:Sema6d UTSW 2 124660745 missense possibly damaging 0.63
R0694:Sema6d UTSW 2 124664041 missense probably damaging 1.00
R0854:Sema6d UTSW 2 124665302 missense probably damaging 0.97
R1630:Sema6d UTSW 2 124664345 missense possibly damaging 0.89
R1682:Sema6d UTSW 2 124665149 missense probably benign 0.21
R1823:Sema6d UTSW 2 124659556 splice site probably null
R1932:Sema6d UTSW 2 124659886 critical splice donor site probably null
R2249:Sema6d UTSW 2 124659588 missense possibly damaging 0.54
R2256:Sema6d UTSW 2 124664150 missense probably damaging 1.00
R2331:Sema6d UTSW 2 124658063 missense probably damaging 1.00
R2910:Sema6d UTSW 2 124665037 missense probably damaging 1.00
R3683:Sema6d UTSW 2 124654226 missense possibly damaging 0.88
R3937:Sema6d UTSW 2 124656850 missense probably benign 0.00
R4135:Sema6d UTSW 2 124664120 missense probably damaging 0.96
R4446:Sema6d UTSW 2 124664059 missense probably damaging 0.98
R4583:Sema6d UTSW 2 124664162 missense probably damaging 1.00
R4599:Sema6d UTSW 2 124654231 missense probably damaging 1.00
R4822:Sema6d UTSW 2 124662294 missense possibly damaging 0.79
R4884:Sema6d UTSW 2 124656818 splice site probably null
R5288:Sema6d UTSW 2 124664246 missense probably damaging 1.00
R5443:Sema6d UTSW 2 124656836 missense probably damaging 1.00
R5504:Sema6d UTSW 2 124658021 missense probably damaging 1.00
R5534:Sema6d UTSW 2 124659815 missense possibly damaging 0.75
R5615:Sema6d UTSW 2 124656901 missense probably damaging 0.97
R5747:Sema6d UTSW 2 124664947 missense probably damaging 0.99
R5866:Sema6d UTSW 2 124664342 missense probably benign 0.26
R5980:Sema6d UTSW 2 124664708 missense probably damaging 1.00
R6670:Sema6d UTSW 2 124654842 small deletion probably benign
R6803:Sema6d UTSW 2 124664050 missense probably damaging 0.96
R7023:Sema6d UTSW 2 124664911 missense probably damaging 1.00
R7068:Sema6d UTSW 2 124657821 missense probably benign
R7426:Sema6d UTSW 2 124654158 missense probably damaging 1.00
R7556:Sema6d UTSW 2 124654189 missense probably damaging 1.00
R7569:Sema6d UTSW 2 124657972 missense possibly damaging 0.92
R8427:Sema6d UTSW 2 124665277 missense probably benign 0.25
R8690:Sema6d UTSW 2 124665017 missense probably benign 0.07
R8711:Sema6d UTSW 2 124660312 missense possibly damaging 0.54
R8757:Sema6d UTSW 2 124655214 missense probably damaging 1.00
R8759:Sema6d UTSW 2 124655214 missense probably damaging 1.00
R8868:Sema6d UTSW 2 124654194 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTCCGAGGCCAATACATGTTATC -3'
(R):5'- TGCTGAACGGTCCACTTCGATG -3'

Sequencing Primer
(F):5'- CTGGGAAATGACATTACTGCTC -3'
(R):5'- GGCTGTCAACCTGTACCTAGTG -3'
Posted On 2013-04-24