Incidental Mutation 'R3921:Olfr1247'
ID315725
Institutional Source Beutler Lab
Gene Symbol Olfr1247
Ensembl Gene ENSMUSG00000075081
Gene Nameolfactory receptor 1247
SynonymsMOR231-6, GA_x6K02T2Q125-51051555-51050611
MMRRC Submission 040818-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R3921 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location89604959-89614130 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 89609509 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 198 (V198I)
Ref Sequence ENSEMBL: ENSMUSP00000149408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099771] [ENSMUST00000111532] [ENSMUST00000216424]
Predicted Effect probably benign
Transcript: ENSMUST00000099771
AA Change: V198I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000097359
Gene: ENSMUSG00000075081
AA Change: V198I

DomainStartEndE-ValueType
Pfam:7tm_1 39 285 4.9e-29 PFAM
Pfam:7tm_4 137 278 4.2e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111532
AA Change: V198I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000107157
Gene: ENSMUSG00000075081
AA Change: V198I

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.2e-48 PFAM
Pfam:7tm_1 39 285 1.6e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216424
AA Change: V198I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik A G 14: 49,774,202 F16S probably benign Het
Aebp2 C T 6: 140,633,735 R11C probably damaging Het
Anxa8 T C 14: 34,094,446 F201L probably damaging Het
Bcl7a A G 5: 123,371,073 N206S probably benign Het
Birc6 A G 17: 74,627,019 N2542D probably damaging Het
Cubn A G 2: 13,326,677 Y2562H probably damaging Het
Dnah12 C G 14: 26,771,051 D1256E probably damaging Het
Dnajb14 A T 3: 137,904,852 R280S probably damaging Het
Dopey1 A T 9: 86,520,271 I1173F probably benign Het
Fam228a T C 12: 4,731,506 T118A probably benign Het
Gata2 TGCCATGGGCTAGGCAAGCC TGCC 6: 88,205,482 probably null Het
Gm5538 T A 3: 59,752,077 L317Q probably damaging Het
Hif3a T C 7: 17,037,172 D618G possibly damaging Het
Ighv1-43 C A 12: 114,946,152 G50V probably benign Het
Lrrc37a G T 11: 103,501,470 T1043N probably benign Het
Masp2 T A 4: 148,605,731 D232E possibly damaging Het
Ms4a4a A C 19: 11,378,808 Q19P probably benign Het
Nckipsd A G 9: 108,814,076 E399G possibly damaging Het
Nnt T A 13: 119,366,494 T572S probably damaging Het
Olfr480 T A 7: 108,065,901 D299V possibly damaging Het
Olig3 A G 10: 19,356,675 D16G probably damaging Het
Polr2b T C 5: 77,326,653 Y446H probably damaging Het
Prtg T C 9: 72,848,347 V277A probably damaging Het
Rnf31 T C 14: 55,601,142 Y857H probably damaging Het
Serac1 T C 17: 6,066,792 D163G probably damaging Het
Slc22a22 C A 15: 57,256,544 V197F probably benign Het
Slc2a10 C T 2: 165,515,601 P394S probably benign Het
Spg7 G C 8: 123,087,373 R457P probably damaging Het
St7 A G 6: 17,846,245 N120D probably benign Het
Sult2a6 C T 7: 14,254,743 V31M possibly damaging Het
Taf3 T C 2: 10,048,298 T35A probably benign Het
Tmem131l A G 3: 83,940,601 I319T possibly damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l T TTGGATG 15: 10,537,563 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Vmn2r9 T G 5: 108,849,055 Y116S probably benign Het
Vstm2l A G 2: 157,935,363 T54A probably benign Het
Xrn1 T A 9: 95,969,284 M153K probably benign Het
Zfp106 G A 2: 120,533,616 P770L probably damaging Het
Other mutations in Olfr1247
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01101:Olfr1247 APN 2 89609847 missense probably benign 0.00
IGL01337:Olfr1247 APN 2 89609376 missense probably damaging 0.97
IGL02537:Olfr1247 APN 2 89609395 missense possibly damaging 0.88
IGL02651:Olfr1247 APN 2 89609498 missense possibly damaging 0.67
IGL02734:Olfr1247 APN 2 89609959 missense probably benign 0.04
IGL03177:Olfr1247 APN 2 89609482 missense probably benign 0.03
IGL03184:Olfr1247 APN 2 89609568 missense probably damaging 1.00
R0207:Olfr1247 UTSW 2 89609863 missense probably damaging 0.97
R0278:Olfr1247 UTSW 2 89609763 missense probably damaging 1.00
R0278:Olfr1247 UTSW 2 89609764 missense probably damaging 1.00
R0601:Olfr1247 UTSW 2 89609220 missense probably benign 0.00
R0633:Olfr1247 UTSW 2 89609374 missense probably benign 0.10
R1824:Olfr1247 UTSW 2 89609349 missense probably damaging 1.00
R1863:Olfr1247 UTSW 2 89609709 nonsense probably null
R2073:Olfr1247 UTSW 2 89609478 missense probably benign 0.01
R2074:Olfr1247 UTSW 2 89609478 missense probably benign 0.01
R2075:Olfr1247 UTSW 2 89609478 missense probably benign 0.01
R4559:Olfr1247 UTSW 2 89609699 missense probably damaging 0.99
R5128:Olfr1247 UTSW 2 89609303 missense probably damaging 1.00
R5140:Olfr1247 UTSW 2 89609283 missense probably damaging 1.00
R5426:Olfr1247 UTSW 2 89609739 missense probably damaging 1.00
R5896:Olfr1247 UTSW 2 89609323 missense probably damaging 0.98
R5902:Olfr1247 UTSW 2 89609251 missense probably damaging 1.00
R6478:Olfr1247 UTSW 2 89609446 missense probably damaging 1.00
R7143:Olfr1247 UTSW 2 89610019 missense probably benign 0.00
R7221:Olfr1247 UTSW 2 89609928 missense probably damaging 1.00
R7599:Olfr1247 UTSW 2 89609227 missense possibly damaging 0.89
Predicted Primers
Posted On2015-05-15