Incidental Mutation 'R3921:Hif3a'
ID315738
Institutional Source Beutler Lab
Gene Symbol Hif3a
Ensembl Gene ENSMUSG00000004328
Gene Namehypoxia inducible factor 3, alpha subunit
SynonymsMOP7, Nepas, bHLHe17
MMRRC Submission 040818-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.201) question?
Stock #R3921 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location17031507-17062427 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17037172 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 618 (D618G)
Ref Sequence ENSEMBL: ENSMUSP00000048248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037762] [ENSMUST00000108492]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037762
AA Change: D618G

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000048248
Gene: ENSMUSG00000004328
AA Change: D618G

DomainStartEndE-ValueType
HLH 18 73 1.57e-7 SMART
PAS 82 148 9.83e-10 SMART
PAS 225 293 2.72e-3 SMART
PAC 299 342 2.18e-2 SMART
low complexity region 421 437 N/A INTRINSIC
Pfam:HIF-1 472 505 1.8e-18 PFAM
low complexity region 508 520 N/A INTRINSIC
low complexity region 525 536 N/A INTRINSIC
low complexity region 595 607 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108492
AA Change: D620G

PolyPhen 2 Score 0.793 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104132
Gene: ENSMUSG00000004328
AA Change: D620G

DomainStartEndE-ValueType
HLH 20 75 1.57e-7 SMART
PAS 84 150 9.83e-10 SMART
PAS 227 295 2.72e-3 SMART
PAC 301 344 2.18e-2 SMART
low complexity region 423 439 N/A INTRINSIC
Pfam:HIF-1 475 506 5.7e-18 PFAM
low complexity region 510 522 N/A INTRINSIC
low complexity region 527 538 N/A INTRINSIC
low complexity region 597 609 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the alpha-3 subunit of one of several alpha/beta-subunit heterodimeric transcription factors that regulate many adaptive responses to low oxygen tension (hypoxia). The alpha-3 subunit lacks the transactivation domain found in factors containing either the alpha-1 or alpha-2 subunits. It is thought that factors containing the alpha-3 subunit are negative regulators of hypoxia-inducible gene expression. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired lung remodeling resulting in hypertrophy of the heart right ventricle and pulmonary hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik A G 14: 49,774,202 F16S probably benign Het
Aebp2 C T 6: 140,633,735 R11C probably damaging Het
Anxa8 T C 14: 34,094,446 F201L probably damaging Het
Bcl7a A G 5: 123,371,073 N206S probably benign Het
Birc6 A G 17: 74,627,019 N2542D probably damaging Het
Cubn A G 2: 13,326,677 Y2562H probably damaging Het
Dnah12 C G 14: 26,771,051 D1256E probably damaging Het
Dnajb14 A T 3: 137,904,852 R280S probably damaging Het
Dopey1 A T 9: 86,520,271 I1173F probably benign Het
Fam228a T C 12: 4,731,506 T118A probably benign Het
Gata2 TGCCATGGGCTAGGCAAGCC TGCC 6: 88,205,482 probably null Het
Gm5538 T A 3: 59,752,077 L317Q probably damaging Het
Ighv1-43 C A 12: 114,946,152 G50V probably benign Het
Lrrc37a G T 11: 103,501,470 T1043N probably benign Het
Masp2 T A 4: 148,605,731 D232E possibly damaging Het
Ms4a4a A C 19: 11,378,808 Q19P probably benign Het
Nckipsd A G 9: 108,814,076 E399G possibly damaging Het
Nnt T A 13: 119,366,494 T572S probably damaging Het
Olfr1247 C T 2: 89,609,509 V198I probably benign Het
Olfr480 T A 7: 108,065,901 D299V possibly damaging Het
Olig3 A G 10: 19,356,675 D16G probably damaging Het
Polr2b T C 5: 77,326,653 Y446H probably damaging Het
Prtg T C 9: 72,848,347 V277A probably damaging Het
Rnf31 T C 14: 55,601,142 Y857H probably damaging Het
Serac1 T C 17: 6,066,792 D163G probably damaging Het
Slc22a22 C A 15: 57,256,544 V197F probably benign Het
Slc2a10 C T 2: 165,515,601 P394S probably benign Het
Spg7 G C 8: 123,087,373 R457P probably damaging Het
St7 A G 6: 17,846,245 N120D probably benign Het
Sult2a6 C T 7: 14,254,743 V31M possibly damaging Het
Taf3 T C 2: 10,048,298 T35A probably benign Het
Tmem131l A G 3: 83,940,601 I319T possibly damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l T TTGGATG 15: 10,537,563 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Vmn2r9 T G 5: 108,849,055 Y116S probably benign Het
Vstm2l A G 2: 157,935,363 T54A probably benign Het
Xrn1 T A 9: 95,969,284 M153K probably benign Het
Zfp106 G A 2: 120,533,616 P770L probably damaging Het
Other mutations in Hif3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Hif3a APN 7 17051916 splice site probably null
IGL02496:Hif3a APN 7 17039678 splice site probably benign
IGL02572:Hif3a APN 7 17050588 missense probably null
IGL02638:Hif3a APN 7 17044368 unclassified probably benign
IGL02704:Hif3a APN 7 17050761 unclassified probably benign
IGL03000:Hif3a APN 7 17048639 missense probably benign 0.08
IGL03342:Hif3a APN 7 17041122 missense possibly damaging 0.92
R0265:Hif3a UTSW 7 17035868 makesense probably null
R0326:Hif3a UTSW 7 17044400 missense probably benign 0.01
R0396:Hif3a UTSW 7 17052021 splice site probably benign
R1494:Hif3a UTSW 7 17054722 missense probably damaging 1.00
R1529:Hif3a UTSW 7 17042639 missense probably benign 0.02
R1548:Hif3a UTSW 7 17044403 missense probably benign 0.00
R1686:Hif3a UTSW 7 17044864 missense possibly damaging 0.46
R1916:Hif3a UTSW 7 17039656 missense possibly damaging 0.87
R2026:Hif3a UTSW 7 17044397 missense possibly damaging 0.81
R2032:Hif3a UTSW 7 17051179 missense probably damaging 1.00
R2354:Hif3a UTSW 7 17041105 missense probably damaging 1.00
R3693:Hif3a UTSW 7 17041074 missense probably damaging 1.00
R3780:Hif3a UTSW 7 17054713 missense probably damaging 1.00
R4003:Hif3a UTSW 7 17044919 missense probably damaging 0.99
R4714:Hif3a UTSW 7 17056271 missense probably damaging 1.00
R4953:Hif3a UTSW 7 17050565 missense probably damaging 0.98
R5632:Hif3a UTSW 7 17050655 missense possibly damaging 0.94
R5778:Hif3a UTSW 7 17051984 missense probably damaging 1.00
R5877:Hif3a UTSW 7 17051146 missense probably damaging 1.00
R5995:Hif3a UTSW 7 17053769 missense probably benign 0.10
R6001:Hif3a UTSW 7 17050561 missense probably damaging 1.00
R6599:Hif3a UTSW 7 17042605 missense possibly damaging 0.68
R7218:Hif3a UTSW 7 17050588 missense probably damaging 1.00
R7478:Hif3a UTSW 7 17042635 missense possibly damaging 0.47
R7479:Hif3a UTSW 7 17042635 missense possibly damaging 0.47
R7480:Hif3a UTSW 7 17042635 missense possibly damaging 0.47
R7482:Hif3a UTSW 7 17042635 missense possibly damaging 0.47
R7654:Hif3a UTSW 7 17049096 missense probably damaging 0.97
R7696:Hif3a UTSW 7 17054787 missense unknown
Predicted Primers PCR Primer
(F):5'- GTGTTTCATCACAGAGAAAAGCAAC -3'
(R):5'- GCACCATACTGCCTTGTCAG -3'

Sequencing Primer
(F):5'- GAGAAAAGCAACCCTAAGATACCCTC -3'
(R):5'- ACTGCCTTGTCAGATACGATG -3'
Posted On2015-05-15