Incidental Mutation 'R3921:Lrrc37a'
ID315746
Institutional Source Beutler Lab
Gene Symbol Lrrc37a
Ensembl Gene ENSMUSG00000078632
Gene Nameleucine rich repeat containing 37A
SynonymsLOC237954
MMRRC Submission 040818-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R3921 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location103451955-103504597 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 103501470 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 1043 (T1043N)
Ref Sequence ENSEMBL: ENSMUSP00000121903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000153273]
Predicted Effect probably benign
Transcript: ENSMUST00000153273
AA Change: T1043N

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000121903
Gene: ENSMUSG00000078632
AA Change: T1043N

DomainStartEndE-ValueType
Pfam:LRRC37 199 269 2.6e-15 PFAM
low complexity region 313 329 N/A INTRINSIC
Pfam:LRRC37 363 432 4e-18 PFAM
low complexity region 457 467 N/A INTRINSIC
low complexity region 480 492 N/A INTRINSIC
Pfam:LRRC37 550 619 2.1e-21 PFAM
Pfam:LRRC37 637 704 2.9e-12 PFAM
Pfam:LRRC37 780 851 2.5e-12 PFAM
Pfam:LRRC37 1078 1148 2.7e-18 PFAM
Pfam:LRRC37 1149 1190 2.1e-7 PFAM
Pfam:LRRC37 1187 1258 2.5e-25 PFAM
Pfam:LRRC37 1255 1300 2.6e-7 PFAM
Pfam:LRRC37 1299 1370 2.4e-27 PFAM
Pfam:LRRC37 1369 1420 2.9e-8 PFAM
Pfam:LRRC37 1419 1488 1.3e-24 PFAM
Pfam:LRRC37 1509 1578 9.2e-21 PFAM
Pfam:LRRC37 1575 1620 1.7e-6 PFAM
Pfam:LRRC37 1619 1686 1.7e-20 PFAM
Pfam:LRRC37 1690 1736 7e-10 PFAM
Pfam:LRRC37 1733 1799 7.5e-17 PFAM
Pfam:LRRC37 1789 1854 5.1e-12 PFAM
Pfam:LRRC37 1850 1921 4.2e-21 PFAM
Pfam:LRRC37 1915 1969 1.1e-9 PFAM
low complexity region 2143 2167 N/A INTRINSIC
low complexity region 2185 2209 N/A INTRINSIC
low complexity region 2228 2249 N/A INTRINSIC
low complexity region 2262 2274 N/A INTRINSIC
low complexity region 2284 2297 N/A INTRINSIC
LRR 2419 2438 3.09e1 SMART
LRR 2439 2462 9.96e-1 SMART
LRR 2463 2486 8.24e0 SMART
LRR 2490 2514 3.18e1 SMART
low complexity region 2535 2547 N/A INTRINSIC
coiled coil region 2712 2735 N/A INTRINSIC
low complexity region 2861 2871 N/A INTRINSIC
low complexity region 2937 2950 N/A INTRINSIC
Pfam:LRRC37AB_C 3063 3209 1.1e-77 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik A G 14: 49,774,202 F16S probably benign Het
Aebp2 C T 6: 140,633,735 R11C probably damaging Het
Anxa8 T C 14: 34,094,446 F201L probably damaging Het
Bcl7a A G 5: 123,371,073 N206S probably benign Het
Birc6 A G 17: 74,627,019 N2542D probably damaging Het
Cubn A G 2: 13,326,677 Y2562H probably damaging Het
Dnah12 C G 14: 26,771,051 D1256E probably damaging Het
Dnajb14 A T 3: 137,904,852 R280S probably damaging Het
Dopey1 A T 9: 86,520,271 I1173F probably benign Het
Fam228a T C 12: 4,731,506 T118A probably benign Het
Gata2 TGCCATGGGCTAGGCAAGCC TGCC 6: 88,205,482 probably null Het
Gm5538 T A 3: 59,752,077 L317Q probably damaging Het
Hif3a T C 7: 17,037,172 D618G possibly damaging Het
Ighv1-43 C A 12: 114,946,152 G50V probably benign Het
Masp2 T A 4: 148,605,731 D232E possibly damaging Het
Ms4a4a A C 19: 11,378,808 Q19P probably benign Het
Nckipsd A G 9: 108,814,076 E399G possibly damaging Het
Nnt T A 13: 119,366,494 T572S probably damaging Het
Olfr1247 C T 2: 89,609,509 V198I probably benign Het
Olfr480 T A 7: 108,065,901 D299V possibly damaging Het
Olig3 A G 10: 19,356,675 D16G probably damaging Het
Polr2b T C 5: 77,326,653 Y446H probably damaging Het
Prtg T C 9: 72,848,347 V277A probably damaging Het
Rnf31 T C 14: 55,601,142 Y857H probably damaging Het
Serac1 T C 17: 6,066,792 D163G probably damaging Het
Slc22a22 C A 15: 57,256,544 V197F probably benign Het
Slc2a10 C T 2: 165,515,601 P394S probably benign Het
Spg7 G C 8: 123,087,373 R457P probably damaging Het
St7 A G 6: 17,846,245 N120D probably benign Het
Sult2a6 C T 7: 14,254,743 V31M possibly damaging Het
Taf3 T C 2: 10,048,298 T35A probably benign Het
Tmem131l A G 3: 83,940,601 I319T possibly damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l T TTGGATG 15: 10,537,563 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Vmn2r9 T G 5: 108,849,055 Y116S probably benign Het
Vstm2l A G 2: 157,935,363 T54A probably benign Het
Xrn1 T A 9: 95,969,284 M153K probably benign Het
Zfp106 G A 2: 120,533,616 P770L probably damaging Het
Other mutations in Lrrc37a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Lrrc37a APN 11 103500351 missense probably benign 0.09
IGL01339:Lrrc37a APN 11 103497937 missense unknown
IGL01352:Lrrc37a APN 11 103499355 missense probably benign 0.39
IGL01382:Lrrc37a APN 11 103498755 missense probably damaging 0.99
IGL01395:Lrrc37a APN 11 103503861 missense probably benign 0.24
IGL01645:Lrrc37a APN 11 103504264 missense probably benign 0.01
IGL01925:Lrrc37a APN 11 103498419 missense probably benign 0.01
IGL02006:Lrrc37a APN 11 103456491 missense probably damaging 1.00
IGL02127:Lrrc37a APN 11 103504539 missense probably benign 0.01
IGL02184:Lrrc37a APN 11 103497609 missense unknown
IGL02218:Lrrc37a APN 11 103500381 missense probably benign 0.03
IGL02436:Lrrc37a APN 11 103498177 missense unknown
IGL02487:Lrrc37a APN 11 103496037 missense unknown
IGL02597:Lrrc37a APN 11 103504287 missense probably benign 0.01
IGL02634:Lrrc37a APN 11 103499112 missense probably benign 0.09
IGL02818:Lrrc37a APN 11 103501306 missense possibly damaging 0.47
IGL02829:Lrrc37a APN 11 103491174 missense unknown
IGL02987:Lrrc37a APN 11 103500413 missense probably benign 0.03
IGL03081:Lrrc37a APN 11 103456595 missense unknown
IGL03210:Lrrc37a APN 11 103499505 missense probably benign 0.29
IGL03239:Lrrc37a APN 11 103499407 missense probably benign 0.03
IGL03285:Lrrc37a APN 11 103497673 missense unknown
IGL03296:Lrrc37a APN 11 103497673 missense unknown
IGL03299:Lrrc37a APN 11 103497673 missense unknown
IGL03370:Lrrc37a APN 11 103497673 missense unknown
IGL03390:Lrrc37a APN 11 103496031 missense unknown
F5770:Lrrc37a UTSW 11 103455512 missense possibly damaging 0.95
P0035:Lrrc37a UTSW 11 103503132 missense possibly damaging 0.84
PIT4458001:Lrrc37a UTSW 11 103504512 missense probably benign 0.04
R0112:Lrrc37a UTSW 11 103500913 missense probably benign 0.19
R0194:Lrrc37a UTSW 11 103499790 missense possibly damaging 0.82
R0360:Lrrc37a UTSW 11 103500640 missense possibly damaging 0.89
R0364:Lrrc37a UTSW 11 103500640 missense possibly damaging 0.89
R0395:Lrrc37a UTSW 11 103464395 missense unknown
R0418:Lrrc37a UTSW 11 103503438 missense probably benign 0.03
R0505:Lrrc37a UTSW 11 103503025 missense probably benign 0.10
R0583:Lrrc37a UTSW 11 103498437 missense probably benign 0.01
R1078:Lrrc37a UTSW 11 103497631 missense unknown
R1581:Lrrc37a UTSW 11 103457017 nonsense probably null
R1888:Lrrc37a UTSW 11 103498761 missense probably benign 0.18
R1888:Lrrc37a UTSW 11 103498761 missense probably benign 0.18
R1907:Lrrc37a UTSW 11 103457156 missense unknown
R1982:Lrrc37a UTSW 11 103498966 missense probably benign 0.20
R1991:Lrrc37a UTSW 11 103500261 missense probably benign 0.29
R2017:Lrrc37a UTSW 11 103501125 missense probably benign 0.03
R2103:Lrrc37a UTSW 11 103500261 missense probably benign 0.29
R2110:Lrrc37a UTSW 11 103497822 missense unknown
R2190:Lrrc37a UTSW 11 103500043 missense possibly damaging 0.82
R2252:Lrrc37a UTSW 11 103501467 missense probably benign 0.01
R2253:Lrrc37a UTSW 11 103501467 missense probably benign 0.01
R2894:Lrrc37a UTSW 11 103497864 missense unknown
R2899:Lrrc37a UTSW 11 103497864 missense unknown
R3439:Lrrc37a UTSW 11 103497864 missense unknown
R3899:Lrrc37a UTSW 11 103497546 missense unknown
R3916:Lrrc37a UTSW 11 103455518 missense possibly damaging 0.83
R3977:Lrrc37a UTSW 11 103457604 missense unknown
R4043:Lrrc37a UTSW 11 103498653 missense possibly damaging 0.95
R4077:Lrrc37a UTSW 11 103497982 missense unknown
R4237:Lrrc37a UTSW 11 103502289 missense probably damaging 0.97
R4461:Lrrc37a UTSW 11 103464354 critical splice donor site probably null
R4498:Lrrc37a UTSW 11 103501798 missense probably benign 0.20
R4593:Lrrc37a UTSW 11 103498969 missense possibly damaging 0.64
R4670:Lrrc37a UTSW 11 103504537 missense probably benign 0.10
R4698:Lrrc37a UTSW 11 103504104 missense possibly damaging 0.83
R4750:Lrrc37a UTSW 11 103455480 missense probably benign 0.24
R4805:Lrrc37a UTSW 11 103504309 missense probably benign 0.01
R4940:Lrrc37a UTSW 11 103497612 missense unknown
R4983:Lrrc37a UTSW 11 103497618 missense unknown
R4989:Lrrc37a UTSW 11 103456739 missense unknown
R5046:Lrrc37a UTSW 11 103498240 missense unknown
R5217:Lrrc37a UTSW 11 103456954 missense unknown
R5300:Lrrc37a UTSW 11 103456958 missense unknown
R5509:Lrrc37a UTSW 11 103500535 missense probably benign 0.23
R5550:Lrrc37a UTSW 11 103498177 missense unknown
R5655:Lrrc37a UTSW 11 103498555 missense probably benign 0.28
R5668:Lrrc37a UTSW 11 103500175 missense probably benign 0.03
R5750:Lrrc37a UTSW 11 103458097 missense unknown
R5815:Lrrc37a UTSW 11 103503786 missense probably benign 0.01
R5976:Lrrc37a UTSW 11 103499071 missense possibly damaging 0.73
R5990:Lrrc37a UTSW 11 103500958 missense probably benign 0.19
R6004:Lrrc37a UTSW 11 103502536 missense possibly damaging 0.56
R6019:Lrrc37a UTSW 11 103456596 missense unknown
R6056:Lrrc37a UTSW 11 103497658 missense unknown
R6125:Lrrc37a UTSW 11 103501560 missense probably benign 0.19
R6190:Lrrc37a UTSW 11 103501216 missense possibly damaging 0.67
R6295:Lrrc37a UTSW 11 103497633 missense unknown
R6320:Lrrc37a UTSW 11 103504051 missense probably benign 0.10
R6354:Lrrc37a UTSW 11 103464387 missense unknown
R6375:Lrrc37a UTSW 11 103501089 missense probably benign 0.19
R6406:Lrrc37a UTSW 11 103497535 missense unknown
R6468:Lrrc37a UTSW 11 103460840 missense unknown
R6490:Lrrc37a UTSW 11 103456660 missense unknown
R6502:Lrrc37a UTSW 11 103492179 missense unknown
R6509:Lrrc37a UTSW 11 103504414 missense probably benign 0.04
R6749:Lrrc37a UTSW 11 103502097 missense probably benign 0.29
R6768:Lrrc37a UTSW 11 103500123 missense probably benign 0.36
R6912:Lrrc37a UTSW 11 103457543 missense unknown
R7081:Lrrc37a UTSW 11 103457955 missense unknown
R7083:Lrrc37a UTSW 11 103503340 missense probably benign 0.03
R7154:Lrrc37a UTSW 11 103502856 missense probably benign 0.03
R7195:Lrrc37a UTSW 11 103457775 missense unknown
R7265:Lrrc37a UTSW 11 103498941 missense probably benign 0.09
R7276:Lrrc37a UTSW 11 103456746 missense unknown
R7362:Lrrc37a UTSW 11 103457509 missense unknown
R7450:Lrrc37a UTSW 11 103498326 missense probably benign 0.01
R7458:Lrrc37a UTSW 11 103497432 missense unknown
R7487:Lrrc37a UTSW 11 103498219 missense unknown
R7535:Lrrc37a UTSW 11 103501857 missense possibly damaging 0.68
R7593:Lrrc37a UTSW 11 103500952 missense probably benign 0.03
R7677:Lrrc37a UTSW 11 103499638 missense probably benign 0.26
R7686:Lrrc37a UTSW 11 103498236 missense unknown
R7694:Lrrc37a UTSW 11 103504378 missense probably benign 0.12
R7696:Lrrc37a UTSW 11 103498437 missense probably benign 0.01
R7717:Lrrc37a UTSW 11 103504300 missense probably benign 0.01
R7736:Lrrc37a UTSW 11 103497459 missense unknown
R7841:Lrrc37a UTSW 11 103501105 missense probably benign 0.03
R7885:Lrrc37a UTSW 11 103503042 missense probably benign 0.01
R7888:Lrrc37a UTSW 11 103501481 missense probably benign 0.19
R7993:Lrrc37a UTSW 11 103457961 missense unknown
R8051:Lrrc37a UTSW 11 103503126 missense possibly damaging 0.48
R8082:Lrrc37a UTSW 11 103457422 missense unknown
R8097:Lrrc37a UTSW 11 103504099 missense probably benign 0.04
R8108:Lrrc37a UTSW 11 103503057 missense probably benign 0.24
R8269:Lrrc37a UTSW 11 103497898 missense unknown
R8311:Lrrc37a UTSW 11 103503421 missense probably benign 0.05
R8403:Lrrc37a UTSW 11 103501585 missense probably benign 0.10
R8408:Lrrc37a UTSW 11 103460809 missense unknown
V7580:Lrrc37a UTSW 11 103455512 missense possibly damaging 0.95
X0018:Lrrc37a UTSW 11 103499544 missense possibly damaging 0.78
Z1176:Lrrc37a UTSW 11 103456486 missense probably damaging 1.00
Z1176:Lrrc37a UTSW 11 103499034 missense possibly damaging 0.68
Z1176:Lrrc37a UTSW 11 103501094 missense probably benign 0.09
Z1177:Lrrc37a UTSW 11 103499967 missense possibly damaging 0.46
Z1177:Lrrc37a UTSW 11 103500520 missense probably benign 0.43
Z1177:Lrrc37a UTSW 11 103500598 missense probably benign 0.20
Z1177:Lrrc37a UTSW 11 103503027 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- AATCTGACCTGGTGTTGGGC -3'
(R):5'- GAATCCCTTAAGGTTCCCACTG -3'

Sequencing Primer
(F):5'- GGCCTATTATTTGCTGTGTTAGAAG -3'
(R):5'- TCCCACTGAACAAGTTGAATATTCAC -3'
Posted On2015-05-15