Incidental Mutation 'R0390:Plcg1'
ID31575
Institutional Source Beutler Lab
Gene Symbol Plcg1
Ensembl Gene ENSMUSG00000016933
Gene Namephospholipase C, gamma 1
SynonymsCded, Plc-gamma1, Plcg-1, Plc-1
MMRRC Submission 038596-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0390 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location160731300-160775760 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 160752366 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 361 (C361F)
Ref Sequence ENSEMBL: ENSMUSP00000133771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103115] [ENSMUST00000109462] [ENSMUST00000151590] [ENSMUST00000174885]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000017077
Predicted Effect probably damaging
Transcript: ENSMUST00000103115
AA Change: C361F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099404
Gene: ENSMUSG00000016933
AA Change: C361F

DomainStartEndE-ValueType
PH 33 144 5.54e-7 SMART
PLCXc 320 464 3.7e-91 SMART
PH 489 680 2.99e1 SMART
SH2 548 645 1.12e-30 SMART
SH2 666 747 3.78e-28 SMART
SH3 794 850 6.49e-16 SMART
PH 804 933 8.93e-2 SMART
PLCYc 953 1070 3.23e-73 SMART
C2 1089 1192 1.37e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109462
AA Change: C361F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105088
Gene: ENSMUSG00000016933
AA Change: C361F

DomainStartEndE-ValueType
PH 33 144 5.54e-7 SMART
Pfam:EF-hand_like 240 318 5.2e-8 PFAM
PLCXc 320 464 3.7e-91 SMART
PH 489 680 2.99e1 SMART
SH2 548 645 1.12e-30 SMART
SH2 666 747 3.78e-28 SMART
SH3 794 850 6.49e-16 SMART
PH 804 933 8.93e-2 SMART
PLCYc 953 1070 3.23e-73 SMART
C2 1089 1192 1.37e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124652
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133937
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147254
Predicted Effect probably damaging
Transcript: ENSMUST00000151590
AA Change: C361F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133771
Gene: ENSMUSG00000016933
AA Change: C361F

DomainStartEndE-ValueType
PH 33 144 5.54e-7 SMART
Pfam:EF-hand_like 239 318 4.4e-8 PFAM
PLCXc 320 464 3.7e-91 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154038
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173335
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173791
Predicted Effect probably benign
Transcript: ENSMUST00000174885
SMART Domains Protein: ENSMUSP00000134720
Gene: ENSMUSG00000016933

DomainStartEndE-ValueType
SCOP:d1mai__ 27 110 2e-16 SMART
Blast:PH 28 110 6e-53 BLAST
Meta Mutation Damage Score 0.9522 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 92.0%
Validation Efficiency 98% (110/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of receptor-mediated tyrosine kinase activators. For example, when activated by SRC, the encoded protein causes the Ras guanine nucleotide exchange factor RasGRP1 to translocate to the Golgi, where it activates Ras. Also, this protein has been shown to be a major substrate for heparin-binding growth factor 1 (acidic fibroblast growth factor)-activated tyrosine kinase. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality associated with arrested growth and/or abnormal hematopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730017C20Rik T A 18: 59,075,688 V136E probably damaging Het
Adam18 C T 8: 24,674,054 G38R probably benign Het
Ap2m1 T C 16: 20,541,099 M183T probably damaging Het
Apob A T 12: 7,988,678 I364F probably damaging Het
Arl6 A T 16: 59,622,421 probably benign Het
Cand2 A G 6: 115,774,653 M15V possibly damaging Het
Cbl A G 9: 44,201,005 F131S probably damaging Het
Ccdc151 T A 9: 21,991,708 H442L probably benign Het
Ccdc74a A G 16: 17,650,476 S321G probably benign Het
Cdc14b T C 13: 64,210,192 probably benign Het
Cep152 T C 2: 125,576,869 probably benign Het
Cep290 A G 10: 100,508,758 E479G probably benign Het
Chrm2 T G 6: 36,524,111 I301R probably benign Het
Clec2e A G 6: 129,093,468 W197R probably damaging Het
Cnot10 G T 9: 114,629,150 S96* probably null Het
Col19a1 A G 1: 24,289,655 probably benign Het
Csmd2 T C 4: 128,133,673 probably benign Het
Cthrc1 A T 15: 39,086,764 *172L probably null Het
Cul9 A T 17: 46,528,589 I821N probably benign Het
Daam1 G C 12: 71,975,304 probably benign Het
Dhx58 A T 11: 100,699,264 I398N probably damaging Het
Dip2b T A 15: 100,193,913 H844Q probably damaging Het
Dmac2 A G 7: 25,621,029 D50G probably damaging Het
Dmxl1 C A 18: 49,879,362 Q1529K probably benign Het
Dtna C T 18: 23,597,501 P315L probably damaging Het
Ep300 T C 15: 81,640,116 S1382P unknown Het
Fat2 A T 11: 55,310,777 N490K probably damaging Het
Flg2 T A 3: 93,200,355 probably benign Het
Gm13084 T A 4: 143,811,699 D234V probably benign Het
Gpatch1 T C 7: 35,281,381 probably benign Het
Grin2a C A 16: 9,579,585 K879N possibly damaging Het
Hacd3 A C 9: 65,001,022 I164S possibly damaging Het
Hinfp A C 9: 44,298,948 C197G probably damaging Het
Hsd17b12 T C 2: 94,114,990 probably benign Het
Hsd3b1 A T 3: 98,853,039 L212Q probably damaging Het
Ifrd1 C T 12: 40,214,094 probably null Het
Igf2bp2 A G 16: 22,081,801 F129L possibly damaging Het
Kirrel3 T A 9: 35,020,163 I409N probably damaging Het
Klhdc10 T C 6: 30,447,412 I204T probably damaging Het
Kpna6 A T 4: 129,657,804 S65R possibly damaging Het
Lama3 A T 18: 12,407,563 D308V probably benign Het
Larp4b T A 13: 9,158,107 probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lyzl1 A T 18: 4,169,175 T11S probably benign Het
Man1c1 A G 4: 134,578,315 L366P probably damaging Het
Mef2a A G 7: 67,251,724 M100T probably damaging Het
Mettl13 G A 1: 162,538,889 H474Y possibly damaging Het
Mmp3 A G 9: 7,451,320 D352G probably benign Het
Mns1 T C 9: 72,452,804 I412T probably damaging Het
Mon2 T C 10: 123,007,021 D1501G probably null Het
Mylk G T 16: 34,875,620 G242W probably damaging Het
Nav1 T C 1: 135,449,966 D1715G possibly damaging Het
Nckap1l T C 15: 103,453,883 S2P probably damaging Het
Nek3 A T 8: 22,128,729 probably benign Het
Nfrkb A G 9: 31,388,897 probably benign Het
Nlrp4d T C 7: 10,388,778 D53G probably benign Het
Nol8 T C 13: 49,662,152 S561P probably damaging Het
Nuf2 A C 1: 169,525,297 probably benign Het
Ofcc1 T A 13: 40,015,313 D866V possibly damaging Het
Olfr195 A G 16: 59,149,299 I150V probably benign Het
Optn A G 2: 5,046,195 L125P probably benign Het
Otoa T A 7: 121,131,341 F588Y probably benign Het
Pappa T A 4: 65,351,613 probably null Het
Pde5a T G 3: 122,835,583 C635W probably damaging Het
Pdgfb A T 15: 80,003,419 probably null Het
Pih1d2 T A 9: 50,621,046 C135S probably damaging Het
Ppp4r4 T C 12: 103,601,360 probably benign Het
Prdm10 G A 9: 31,349,268 probably null Het
Prex2 T A 1: 11,089,706 probably null Het
Prss56 T G 1: 87,184,730 probably null Het
Prtg A G 9: 72,844,958 K209E probably benign Het
Ptprc G A 1: 138,122,575 T36I possibly damaging Het
Rasgrp4 A G 7: 29,145,860 Y302C probably damaging Het
Rb1cc1 T A 1: 6,248,634 M759K probably damaging Het
Rbm15b T A 9: 106,885,998 M324L probably benign Het
Rcbtb2 T C 14: 73,178,547 V500A probably damaging Het
Rgs6 A G 12: 83,133,677 K434R probably damaging Het
Rims1 C T 1: 22,596,526 A125T possibly damaging Het
Robo3 A G 9: 37,422,177 V746A probably benign Het
Rtl1 C T 12: 109,591,386 E1340K unknown Het
Sacs G A 14: 61,205,640 D1712N possibly damaging Het
Samd4b G A 7: 28,403,977 P19S probably benign Het
Samhd1 T C 2: 157,114,231 Y347C probably damaging Het
Sema6d T A 2: 124,658,490 I393N probably damaging Het
Sigmar1 C T 4: 41,741,243 A4T probably benign Het
Skint9 C A 4: 112,389,179 L245F probably benign Het
Slc35f5 T C 1: 125,585,095 L372P probably damaging Het
Smc1b A T 15: 85,066,277 I1182N probably damaging Het
Smyd3 A G 1: 178,957,573 probably benign Het
Sptlc1 T C 13: 53,337,612 D417G probably benign Het
Sv2c T C 13: 96,088,708 N31S probably benign Het
Tjp1 T C 7: 65,314,990 D811G probably damaging Het
Top2b A G 14: 16,418,442 T1221A probably benign Het
Tph2 T C 10: 115,174,109 D182G probably damaging Het
Traf6 C T 2: 101,688,588 Q141* probably null Het
Ttn T C 2: 76,756,931 D21574G probably damaging Het
Uba2 T A 7: 34,151,021 N367I probably benign Het
Ube2b T C 11: 51,988,602 probably benign Het
Ubr5 G T 15: 38,030,672 L426I probably benign Het
Ugt2a2 T A 5: 87,464,148 H301L probably benign Het
Upf2 T A 2: 6,018,894 probably benign Het
Utrn T C 10: 12,710,060 D991G probably benign Het
Vmn2r25 T C 6: 123,823,181 D734G probably damaging Het
Vmn2r68 T A 7: 85,233,249 probably benign Het
Vmn2r68 C G 7: 85,233,258 probably null Het
Vwf T A 6: 125,626,361 Y891* probably null Het
Wwox C T 8: 114,706,278 T228I probably benign Het
Zer1 C T 2: 30,108,213 probably benign Het
Zfp180 C T 7: 24,104,707 H184Y possibly damaging Het
Zfp68 A T 5: 138,607,225 Y279N probably benign Het
Other mutations in Plcg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Plcg1 APN 2 160757266 missense probably damaging 1.00
IGL00885:Plcg1 APN 2 160758083 missense probably benign 0.03
IGL01066:Plcg1 APN 2 160754398 missense probably damaging 1.00
IGL01356:Plcg1 APN 2 160753893 missense probably damaging 1.00
IGL01629:Plcg1 APN 2 160758010 missense possibly damaging 0.69
IGL01732:Plcg1 APN 2 160747779 missense probably damaging 0.97
IGL01754:Plcg1 APN 2 160761433 missense probably damaging 1.00
IGL02195:Plcg1 APN 2 160753926 missense possibly damaging 0.83
IGL02371:Plcg1 APN 2 160753507 missense probably damaging 0.99
IGL02671:Plcg1 APN 2 160755752 nonsense probably null
IGL03096:Plcg1 APN 2 160757206 splice site probably benign
IGL03129:Plcg1 APN 2 160774526 critical splice acceptor site probably null
IGL03139:Plcg1 APN 2 160748129 critical splice donor site probably null
IGL03211:Plcg1 APN 2 160759691 missense possibly damaging 0.82
suscepit UTSW 2 160753602 intron probably null
IGL03047:Plcg1 UTSW 2 160754879 missense probably damaging 1.00
R0098:Plcg1 UTSW 2 160732000 missense probably damaging 1.00
R0413:Plcg1 UTSW 2 160761429 missense probably damaging 1.00
R0650:Plcg1 UTSW 2 160753363 splice site probably benign
R0679:Plcg1 UTSW 2 160756910 missense probably damaging 1.00
R0709:Plcg1 UTSW 2 160751778 splice site probably null
R1719:Plcg1 UTSW 2 160753743 missense probably null 0.94
R1721:Plcg1 UTSW 2 160731920 missense probably damaging 0.99
R1727:Plcg1 UTSW 2 160748088 missense probably benign 0.00
R1978:Plcg1 UTSW 2 160752578 unclassified probably null
R2277:Plcg1 UTSW 2 160755805 missense possibly damaging 0.48
R2698:Plcg1 UTSW 2 160761463 missense possibly damaging 0.90
R3832:Plcg1 UTSW 2 160754437 missense possibly damaging 0.95
R4094:Plcg1 UTSW 2 160747841 missense probably damaging 0.98
R4260:Plcg1 UTSW 2 160751707 critical splice donor site probably null
R4622:Plcg1 UTSW 2 160747768 splice site probably benign
R4837:Plcg1 UTSW 2 160750986 missense probably benign 0.00
R4942:Plcg1 UTSW 2 160753589 intron probably null
R5514:Plcg1 UTSW 2 160753355 critical splice donor site probably null
R5647:Plcg1 UTSW 2 160751668 missense probably benign 0.45
R5929:Plcg1 UTSW 2 160753602 intron probably null
R6303:Plcg1 UTSW 2 160761463 missense possibly damaging 0.90
R6304:Plcg1 UTSW 2 160761463 missense possibly damaging 0.90
R6471:Plcg1 UTSW 2 160753710 missense probably benign 0.10
R6500:Plcg1 UTSW 2 160754567 missense probably damaging 1.00
R7017:Plcg1 UTSW 2 160758097 missense probably damaging 1.00
R7113:Plcg1 UTSW 2 160748283 missense possibly damaging 0.78
R7137:Plcg1 UTSW 2 160753926 missense possibly damaging 0.83
R7155:Plcg1 UTSW 2 160754380 missense probably damaging 1.00
R7211:Plcg1 UTSW 2 160731874 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGCAGCCAGCACTCATTCACTTTC -3'
(R):5'- ATGCTCCTTGATGGTGTGCAGGAC -3'

Sequencing Primer
(F):5'- TTCTCCAAAGAGAACAGCGTG -3'
(R):5'- ACGTCAGAGAACTTGATCTTGG -3'
Posted On2013-04-24