Incidental Mutation 'R3921:Anxa8'
ID315750
Institutional Source Beutler Lab
Gene Symbol Anxa8
Ensembl Gene ENSMUSG00000021950
Gene Nameannexin A8
SynonymsAnx8
MMRRC Submission 040818-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3921 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location34085981-34100571 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34094446 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 201 (F201L)
Ref Sequence ENSEMBL: ENSMUSP00000022519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022519] [ENSMUST00000120077] [ENSMUST00000178958]
Predicted Effect probably damaging
Transcript: ENSMUST00000022519
AA Change: F201L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022519
Gene: ENSMUSG00000021950
AA Change: F201L

DomainStartEndE-ValueType
ANX 38 90 6.69e-25 SMART
ANX 110 162 5.57e-22 SMART
ANX 195 247 1.12e-17 SMART
ANX 270 322 9.26e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120077
SMART Domains Protein: ENSMUSP00000113662
Gene: ENSMUSG00000021950

DomainStartEndE-ValueType
ANX 38 90 6.69e-25 SMART
ANX 110 162 5.57e-22 SMART
ANX 165 221 4.14e-1 SMART
ANX 244 296 9.26e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215823
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a floxed allele activated in all cells exhibit impaired leukocyte rolling flux and adhesion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik A G 14: 49,774,202 F16S probably benign Het
Aebp2 C T 6: 140,633,735 R11C probably damaging Het
Bcl7a A G 5: 123,371,073 N206S probably benign Het
Birc6 A G 17: 74,627,019 N2542D probably damaging Het
Cubn A G 2: 13,326,677 Y2562H probably damaging Het
Dnah12 C G 14: 26,771,051 D1256E probably damaging Het
Dnajb14 A T 3: 137,904,852 R280S probably damaging Het
Dopey1 A T 9: 86,520,271 I1173F probably benign Het
Fam228a T C 12: 4,731,506 T118A probably benign Het
Gata2 TGCCATGGGCTAGGCAAGCC TGCC 6: 88,205,482 probably null Het
Gm5538 T A 3: 59,752,077 L317Q probably damaging Het
Hif3a T C 7: 17,037,172 D618G possibly damaging Het
Ighv1-43 C A 12: 114,946,152 G50V probably benign Het
Lrrc37a G T 11: 103,501,470 T1043N probably benign Het
Masp2 T A 4: 148,605,731 D232E possibly damaging Het
Ms4a4a A C 19: 11,378,808 Q19P probably benign Het
Nckipsd A G 9: 108,814,076 E399G possibly damaging Het
Nnt T A 13: 119,366,494 T572S probably damaging Het
Olfr1247 C T 2: 89,609,509 V198I probably benign Het
Olfr480 T A 7: 108,065,901 D299V possibly damaging Het
Olig3 A G 10: 19,356,675 D16G probably damaging Het
Polr2b T C 5: 77,326,653 Y446H probably damaging Het
Prtg T C 9: 72,848,347 V277A probably damaging Het
Rnf31 T C 14: 55,601,142 Y857H probably damaging Het
Serac1 T C 17: 6,066,792 D163G probably damaging Het
Slc22a22 C A 15: 57,256,544 V197F probably benign Het
Slc2a10 C T 2: 165,515,601 P394S probably benign Het
Spg7 G C 8: 123,087,373 R457P probably damaging Het
St7 A G 6: 17,846,245 N120D probably benign Het
Sult2a6 C T 7: 14,254,743 V31M possibly damaging Het
Taf3 T C 2: 10,048,298 T35A probably benign Het
Tmem131l A G 3: 83,940,601 I319T possibly damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l T TTGGATG 15: 10,537,563 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Vmn2r9 T G 5: 108,849,055 Y116S probably benign Het
Vstm2l A G 2: 157,935,363 T54A probably benign Het
Xrn1 T A 9: 95,969,284 M153K probably benign Het
Zfp106 G A 2: 120,533,616 P770L probably damaging Het
Other mutations in Anxa8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01300:Anxa8 APN 14 34099743 missense probably benign 0.33
IGL01335:Anxa8 APN 14 34089590 missense probably damaging 1.00
IGL02131:Anxa8 APN 14 34090631 missense possibly damaging 0.90
IGL02675:Anxa8 APN 14 34093414 missense probably damaging 0.98
IGL02887:Anxa8 APN 14 34096524 splice site probably null
R0095:Anxa8 UTSW 14 34086071 missense probably benign 0.19
R0095:Anxa8 UTSW 14 34086071 missense probably benign 0.19
R0138:Anxa8 UTSW 14 34097939 missense probably benign 0.01
R0138:Anxa8 UTSW 14 34097940 missense possibly damaging 0.54
R0452:Anxa8 UTSW 14 34094770 missense probably damaging 1.00
R1586:Anxa8 UTSW 14 34093937 missense probably damaging 1.00
R1727:Anxa8 UTSW 14 34089590 missense probably damaging 1.00
R1982:Anxa8 UTSW 14 34096570 missense probably damaging 1.00
R2141:Anxa8 UTSW 14 34091916 critical splice donor site probably null
R4803:Anxa8 UTSW 14 34092622 critical splice donor site probably null
R5372:Anxa8 UTSW 14 34093911 missense probably damaging 1.00
R6349:Anxa8 UTSW 14 34097893 missense probably damaging 0.98
R6823:Anxa8 UTSW 14 34094765 missense possibly damaging 0.88
R6837:Anxa8 UTSW 14 34092554 missense probably damaging 1.00
R8079:Anxa8 UTSW 14 34094812 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TACTCAGTGCTCCCAGAGAC -3'
(R):5'- AAGGTCTCCATGGCTCTCTC -3'

Sequencing Primer
(F):5'- TTCTAAAGAAGCTGATGGCCC -3'
(R):5'- TCCCCAAGTCTAAGCTGCTTAAG -3'
Posted On2015-05-15