Incidental Mutation 'R4042:Prss40'
ID315760
Institutional Source Beutler Lab
Gene Symbol Prss40
Ensembl Gene ENSMUSG00000037529
Gene Nameprotease, serine 40
SynonymsTesp2
MMRRC Submission 040851-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4042 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location34543968-34560943 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 34560879 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 9 (S9*)
Ref Sequence ENSEMBL: ENSMUSP00000110723 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047840] [ENSMUST00000115071] [ENSMUST00000190790]
Predicted Effect probably null
Transcript: ENSMUST00000047840
AA Change: S9*
SMART Domains Protein: ENSMUSP00000045118
Gene: ENSMUSG00000037529
AA Change: S9*

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
Tryp_SPc 68 308 1.45e-71 SMART
low complexity region 309 319 N/A INTRINSIC
low complexity region 354 365 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115071
AA Change: S9*
SMART Domains Protein: ENSMUSP00000110723
Gene: ENSMUSG00000037529
AA Change: S9*

DomainStartEndE-ValueType
Tryp_SPc 1 146 8.36e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190790
SMART Domains Protein: ENSMUSP00000140885
Gene: ENSMUSG00000037529

DomainStartEndE-ValueType
Tryp_SPc 4 145 2.3e-7 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik A T 19: 28,945,783 C80S possibly damaging Het
4930415L06Rik A G X: 89,932,303 F96S probably damaging Het
Adamts10 A G 17: 33,549,540 H864R possibly damaging Het
Akap6 A T 12: 53,139,379 probably null Het
Alox5 A G 6: 116,461,018 S3P possibly damaging Het
Bcl2l2 G A 14: 54,884,634 E85K possibly damaging Het
Chd6 A T 2: 160,988,333 I1014N probably damaging Het
Cog1 A T 11: 113,661,010 Q156L probably damaging Het
Col28a1 G A 6: 8,014,678 S909F probably damaging Het
Csmd3 C T 15: 47,614,084 G3339D probably damaging Het
Cst11 A G 2: 148,771,280 S42P probably benign Het
Cyp2d10 C T 15: 82,406,068 R67H probably benign Het
D330045A20Rik C T X: 139,507,003 S364L probably damaging Homo
Fsip2 G T 2: 82,983,552 R3405L probably benign Het
H2-Ab1 T C 17: 34,264,860 V65A probably benign Het
Hdac6 T C X: 7,931,492 T993A probably benign Het
Insrr T A 3: 87,813,827 M1095K probably damaging Het
Itih4 A T 14: 30,895,038 N517I probably damaging Het
Krt10 C T 11: 99,386,993 probably null Het
Mettl16 T A 11: 74,792,292 F187I probably damaging Het
Miga2 T C 2: 30,367,726 I12T possibly damaging Het
Muc5b T C 7: 141,864,887 Y3857H possibly damaging Het
Ncoa1 A G 12: 4,267,871 S165P probably damaging Het
Olfr1432 A T 19: 12,229,312 I83N probably benign Het
Otol1 A G 3: 70,027,779 D368G probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Plxnb1 A G 9: 109,105,173 D823G probably benign Het
Ppme1 A G 7: 100,341,065 S226P probably damaging Het
Prune2 T C 19: 17,003,826 probably null Het
Rgl2 C T 17: 33,937,262 R775W probably damaging Het
Rpp40 A G 13: 35,898,566 C275R probably benign Het
Rrm2 T C 12: 24,711,451 Y162H probably benign Het
Syne1 T C 10: 5,041,584 M8377V probably benign Het
Uchl4 A C 9: 64,235,557 I107L probably benign Het
Ush1c T C 7: 46,221,528 E276G probably damaging Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vcan T A 13: 89,692,543 L1627F probably benign Het
Ythdc1 T C 5: 86,816,524 I76T probably benign Het
Other mutations in Prss40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00647:Prss40 APN 1 34552539 missense probably benign 0.01
IGL01298:Prss40 APN 1 34560766 missense probably benign
IGL01694:Prss40 APN 1 34556097 missense probably benign 0.02
IGL03030:Prss40 APN 1 34558101 missense probably damaging 0.99
IGL03393:Prss40 APN 1 34558101 missense probably damaging 0.99
R0294:Prss40 UTSW 1 34556081 missense possibly damaging 0.58
R1450:Prss40 UTSW 1 34556097 missense probably benign 0.02
R1987:Prss40 UTSW 1 34558014 missense possibly damaging 0.75
R2356:Prss40 UTSW 1 34559903 nonsense probably null
R2395:Prss40 UTSW 1 34559905 missense possibly damaging 0.86
R4043:Prss40 UTSW 1 34560879 nonsense probably null
R4044:Prss40 UTSW 1 34560879 nonsense probably null
R4232:Prss40 UTSW 1 34560792 missense probably benign 0.07
R5418:Prss40 UTSW 1 34560759 missense probably benign 0.00
R5539:Prss40 UTSW 1 34552679 makesense probably null
R5719:Prss40 UTSW 1 34552517 utr 3 prime probably benign
R6365:Prss40 UTSW 1 34552517 utr 3 prime probably benign
R7002:Prss40 UTSW 1 34552400 utr 3 prime probably null
R7366:Prss40 UTSW 1 34559871 nonsense probably null
R7521:Prss40 UTSW 1 34558009 missense probably benign 0.03
R7777:Prss40 UTSW 1 34552765 nonsense probably null
R8138:Prss40 UTSW 1 34557999 missense probably damaging 0.99
Z1176:Prss40 UTSW 1 34559779 missense possibly damaging 0.85
Z1177:Prss40 UTSW 1 34552586 missense probably benign 0.00
Z1177:Prss40 UTSW 1 34560819 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACCTGCCTCCGACTTTAAAGG -3'
(R):5'- TCAGAATTGTTTCCGTGAAAGCC -3'

Sequencing Primer
(F):5'- TCCGACTTTAAAGGCCACC -3'
(R):5'- TTGTTTCCGTGAAAGCCAGAGAAG -3'
Posted On2015-05-15