Incidental Mutation 'R4042:Cst11'
ID315763
Institutional Source Beutler Lab
Gene Symbol Cst11
Ensembl Gene ENSMUSG00000036958
Gene Namecystatin 11
SynonymsmCST E1, 9230101F08Rik, CRES2, cystatin E1
MMRRC Submission 040851-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R4042 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location148768609-148771497 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 148771280 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 42 (S42P)
Ref Sequence ENSEMBL: ENSMUSP00000028934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028934]
Predicted Effect probably benign
Transcript: ENSMUST00000028934
AA Change: S42P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000028934
Gene: ENSMUSG00000036958
AA Change: S42P

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CY 32 136 2.24e-13 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions. The cystatin locus on chromosome 20 contains the majority of the type 2 cystatin genes and pseudogenes. This gene is located in the cystatin locus and encodes an epididymal-specific protein shown to have antimicrobial activity against E. coli. Alternative splicing yields two variants encoding distinct isoforms. [provided by RefSeq, Sep 2014]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik A T 19: 28,945,783 C80S possibly damaging Het
4930415L06Rik A G X: 89,932,303 F96S probably damaging Het
Adamts10 A G 17: 33,549,540 H864R possibly damaging Het
Akap6 A T 12: 53,139,379 probably null Het
Alox5 A G 6: 116,461,018 S3P possibly damaging Het
Bcl2l2 G A 14: 54,884,634 E85K possibly damaging Het
Chd6 A T 2: 160,988,333 I1014N probably damaging Het
Cog1 A T 11: 113,661,010 Q156L probably damaging Het
Col28a1 G A 6: 8,014,678 S909F probably damaging Het
Csmd3 C T 15: 47,614,084 G3339D probably damaging Het
Cyp2d10 C T 15: 82,406,068 R67H probably benign Het
D330045A20Rik C T X: 139,507,003 S364L probably damaging Homo
Fsip2 G T 2: 82,983,552 R3405L probably benign Het
H2-Ab1 T C 17: 34,264,860 V65A probably benign Het
Hdac6 T C X: 7,931,492 T993A probably benign Het
Insrr T A 3: 87,813,827 M1095K probably damaging Het
Itih4 A T 14: 30,895,038 N517I probably damaging Het
Krt10 C T 11: 99,386,993 probably null Het
Mettl16 T A 11: 74,792,292 F187I probably damaging Het
Miga2 T C 2: 30,367,726 I12T possibly damaging Het
Muc5b T C 7: 141,864,887 Y3857H possibly damaging Het
Ncoa1 A G 12: 4,267,871 S165P probably damaging Het
Olfr1432 A T 19: 12,229,312 I83N probably benign Het
Otol1 A G 3: 70,027,779 D368G probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Plxnb1 A G 9: 109,105,173 D823G probably benign Het
Ppme1 A G 7: 100,341,065 S226P probably damaging Het
Prss40 G T 1: 34,560,879 S9* probably null Het
Prune2 T C 19: 17,003,826 probably null Het
Rgl2 C T 17: 33,937,262 R775W probably damaging Het
Rpp40 A G 13: 35,898,566 C275R probably benign Het
Rrm2 T C 12: 24,711,451 Y162H probably benign Het
Syne1 T C 10: 5,041,584 M8377V probably benign Het
Uchl4 A C 9: 64,235,557 I107L probably benign Het
Ush1c T C 7: 46,221,528 E276G probably damaging Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vcan T A 13: 89,692,543 L1627F probably benign Het
Ythdc1 T C 5: 86,816,524 I76T probably benign Het
Other mutations in Cst11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02271:Cst11 APN 2 148771241 missense probably damaging 1.00
R0020:Cst11 UTSW 2 148771333 missense probably damaging 0.97
R0020:Cst11 UTSW 2 148771333 missense probably damaging 0.97
R0060:Cst11 UTSW 2 148770402 missense probably damaging 1.00
R0988:Cst11 UTSW 2 148770426 missense probably benign 0.26
R2102:Cst11 UTSW 2 148771240 missense probably damaging 1.00
R5008:Cst11 UTSW 2 148770405 missense probably benign 0.24
R5768:Cst11 UTSW 2 148770467 nonsense probably null
R7140:Cst11 UTSW 2 148768729 missense probably benign 0.36
R7841:Cst11 UTSW 2 148771307 missense possibly damaging 0.93
R7924:Cst11 UTSW 2 148771307 missense possibly damaging 0.93
X0024:Cst11 UTSW 2 148770460 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TCTGCACAGTGAGATCTCATC -3'
(R):5'- TTCCCTTAAGCCTGACCCAG -3'

Sequencing Primer
(F):5'- TCTGCACAGTGAGATCTCATCAAAAC -3'
(R):5'- ACCCAGAGACACTGTGGTCAG -3'
Posted On2015-05-15